Rh5AG302200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Forward (+)
42569532 .. 42574923
5392 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG302200.1

Sequence Viewer

Length: 201 bp
ATGTGTGATGTAGGAGGAGCAATCCTAGAAGCAATCACTACCATTCAAACCCACTTCTCTAAACACCAAACCAGAAAACTCGTTGGTATGAAAGATTGGAGCTACTTTTCATTGCTTGATGCAATGATGCCTAATGCCTTGATTTGCTATTTTGCTTCGGTCAATCTCGAGTTCTCGACCAGACGACCACTGATCACCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

7.48

Weight (kDa)

7.83

Isoelectric Point (pI)

28.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 47
AluBI AGCT 1 cut(s) 102
AluI AGCT 1 cut(s) 102
Ama87I CYCGRG 1 cut(s) 167
AsuHPI GGTGA 1 cut(s) 187
AvaI CYCGRG 1 cut(s) 167
BclI TGATCA 1 cut(s) 192
BfaI CTAG 1 cut(s) 26
BmeT110I CYCGRG 1 cut(s) 167
BmsI GCATC 2 cut(s) 109, 117
Bse3DI GCAATG 2 cut(s) 110, 129
BseMI GCAATG 2 cut(s) 110, 129
BseRI GAGGAG 1 cut(s) 30
BsiHKCI CYCGRG 1 cut(s) 167
BsoBI CYCGRG 1 cut(s) 167
Bsp143I GATC 1 cut(s) 192
BsrDI GCAATG 2 cut(s) 110, 129
BssMI GATC 1 cut(s) 192
BstKTI GATC 1 cut(s) 195
BstMBI GATC 1 cut(s) 192
BtsIMutI CAGTG 1 cut(s) 188
CviJI RGCY 1 cut(s) 102
CviKI_1 RGCY 1 cut(s) 102
DpnI GATC 1 cut(s) 194
DpnII GATC 1 cut(s) 192
Eco88I CYCGRG 1 cut(s) 167
FaiI YATR 1 cut(s) 89
FbaI TGATCA 1 cut(s) 192
FspBI CTAG 1 cut(s) 26
HphI GGTGA 1 cut(s) 187
Hpy188III TCNNGA 2 cut(s) 167, 175
HpyCH4V TGCA 1 cut(s) 122
Ksp22I TGATCA 1 cut(s) 192
Kzo9I GATC 1 cut(s) 192
LmnI GCTCC 2 cut(s) 17, 99
LpnPI CCDG 2 cut(s) 85, 193
LweI GCATC 2 cut(s) 109, 117
MaeI CTAG 1 cut(s) 26
MalI GATC 1 cut(s) 194
MboI GATC 1 cut(s) 192
MnlI CCTC 1 cut(s) 8
NdeII GATC 1 cut(s) 192
PaeR7I CTCGAG 1 cut(s) 167
Sau3AI GATC 1 cut(s) 192
SetI ASST 2 cut(s) 104, 200
SfaNI GCATC 2 cut(s) 109, 117
Sfr274I CTCGAG 1 cut(s) 167
SgeI CNNG 9 cut(s) 38, 84, 92, 128, 151, 179, 181, 187, 192
SlaI CTCGAG 1 cut(s) 167
SmlI CTYRAG 1 cut(s) 167
SmoI CTYRAG 1 cut(s) 167
SspMI CTAG 1 cut(s) 26
TaqI TCGA 2 cut(s) 168, 176
TaqII GACCGA 1 cut(s) 148
TscAI CASTG 1 cut(s) 195
TspDTI ATGAA 2 cut(s) 99, 104
TspRI CASTG 1 cut(s) 195
XhoI CTCGAG 1 cut(s) 167
XspI CTAG 1 cut(s) 26
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.