RchiOBHm_Chr2g0165651

E3 ubiquitin-protein ligase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
80531784 .. 80533479
1696 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 126 bp
ATGCTGCTGAGTGGGAATGAGAGGCTGCCTGGTGCTGTTGTGCCTGCTAGGGAGAGGCTACTTGAGAGGTTGAGAGGAATGTCTCATTTGGAAACCAGTTATATGAATATGAACCAAGTAAGATGA

Protein Analysis

41

Amino Acids

4.73

Weight (kDa)

10.57

Isoelectric Point (pI)

40.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjnI CCWGG 1 cut(s) 28
Alw26I GTCTC 1 cut(s) 87
ApeKI GCWGC 2 cut(s) 4, 25
BbvI GCAGC 1 cut(s) 12
BciT130I CCWGG 1 cut(s) 30
BcoDI GTCTC 1 cut(s) 87
BfaI CTAG 1 cut(s) 48
BisI GCNGC 2 cut(s) 5, 26
BlsI GCNGC 2 cut(s) 6, 27
Bme1390I CCNGG 1 cut(s) 30
BmrFI CCNGG 1 cut(s) 30
BpuEI CTTGAG 1 cut(s) 83
Bse1I ACTGG 1 cut(s) 96
BseBI CCWGG 1 cut(s) 30
BseNI ACTGG 1 cut(s) 96
BseXI GCAGC 1 cut(s) 12
BsmAI GTCTC 1 cut(s) 87
BsrI ACTGG 1 cut(s) 96
Bst2UI CCWGG 1 cut(s) 30
BstC8I GCNNGC 1 cut(s) 45
BstDEI CTNAG 1 cut(s) 8
BstMAI GTCTC 1 cut(s) 87
BstNI CCWGG 1 cut(s) 30
BstSCI CCNGG 1 cut(s) 28
BstV1I GCAGC 1 cut(s) 12
Cac8I GCNNGC 1 cut(s) 45
CviJI RGCY 2 cut(s) 25, 58
CviKI_1 RGCY 2 cut(s) 25, 58
DdeI CTNAG 1 cut(s) 8
EcoRII CCWGG 1 cut(s) 28
FaiI YATR 3 cut(s) 102, 104, 110
Fnu4HI GCNGC 2 cut(s) 5, 26
Fsp4HI GCNGC 2 cut(s) 5, 26
FspBI CTAG 1 cut(s) 48
GluI GCNGC 2 cut(s) 5, 26
HpyF3I CTNAG 1 cut(s) 8
LpnPI CCDG 4 cut(s) 15, 42, 57, 109
Lsp1109I GCAGC 1 cut(s) 12
MaeI CTAG 1 cut(s) 48
MnlI CCTC 4 cut(s) 15, 48, 60, 68
MspR9I CCNGG 1 cut(s) 30
MvaI CCWGG 1 cut(s) 30
PkrI GCNGC 2 cut(s) 6, 27
Psp6I CCWGG 1 cut(s) 28
PspGI CCWGG 1 cut(s) 28
SatI GCNGC 2 cut(s) 5, 26
ScrFI CCNGG 1 cut(s) 30
SetI ASST 1 cut(s) 71
SgeI CNNG 6 cut(s) 41, 42, 56, 60, 74, 108
SmlI CTYRAG 1 cut(s) 62
SmoI CTYRAG 1 cut(s) 62
SspMI CTAG 1 cut(s) 48
StyD4I CCNGG 1 cut(s) 28
TseI GCWGC 2 cut(s) 4, 25
TspDTI ATGAA 2 cut(s) 119, 125
XspI CTAG 1 cut(s) 48
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.