RchiOBHm_Chr1g0313751

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
831595 .. 832237
643 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ54455

Sequence Viewer

Length: 216 bp
ATGGAAGAACTCTATGCAGCAGTGATTCTGTTTGGAAGGCCTTGGTTTTTTATGCCAAAAATTGTAAATGCTTCTTTAATGTTGATCAAGACAAGGATTTGGCAAGGCCATAGTAGACGTAAAGAAGTGTTGGACCAATTTGATGATTTGCTCAATGCCGACAACATAATTTTCAAAAATGCTAGATGCAAGGTGCTTTTAGTGATAACTTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

8.4

Weight (kDa)

9.43

Isoelectric Point (pI)

40.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 115
AgsI TTSAA 1 cut(s) 175
AoxI GGCC 2 cut(s) 38, 106
ApeKI GCWGC 1 cut(s) 17
AspS9I GGNCC 1 cut(s) 133
AvaII GGWCC 1 cut(s) 133
BbvI GCAGC 1 cut(s) 29
BclI TGATCA 1 cut(s) 84
BfaI CTAG 1 cut(s) 183
BisI GCNGC 1 cut(s) 18
BlsI GCNGC 1 cut(s) 19
Bme18I GGWCC 1 cut(s) 133
BmgT120I GGNCC 1 cut(s) 133
BmsI GCATC 1 cut(s) 176
BsaJI CCNNGG 1 cut(s) 41
BseDI CCNNGG 1 cut(s) 41
BseXI GCAGC 1 cut(s) 29
BshFI GGCC 2 cut(s) 40, 108
BsnI GGCC 2 cut(s) 40, 108
Bsp143I GATC 1 cut(s) 84
BspANI GGCC 2 cut(s) 40, 108
BssECI CCNNGG 1 cut(s) 41
BssMI GATC 1 cut(s) 84
BssT1I CCWWGG 1 cut(s) 41
BstKTI GATC 1 cut(s) 87
BstMBI GATC 1 cut(s) 84
BstV1I GCAGC 1 cut(s) 29
BsuRI GGCC 2 cut(s) 40, 108
BtsI GCAGTG 1 cut(s) 27
BtsIMutI CAGTG 1 cut(s) 27
Cfr13I GGNCC 1 cut(s) 133
CviJI RGCY 2 cut(s) 40, 108
CviKI_1 RGCY 2 cut(s) 40, 108
DpnI GATC 1 cut(s) 86
DpnII GATC 1 cut(s) 84
Eco130I CCWWGG 1 cut(s) 41
Eco147I AGGCCT 1 cut(s) 40
Eco47I GGWCC 1 cut(s) 133
EcoT14I CCWWGG 1 cut(s) 41
ErhI CCWWGG 1 cut(s) 41
FaiI YATR 4 cut(s) 15, 53, 111, 167
FbaI TGATCA 1 cut(s) 84
FblI GTMKAC 1 cut(s) 115
Fnu4HI GCNGC 1 cut(s) 18
Fsp4HI GCNGC 1 cut(s) 18
FspBI CTAG 1 cut(s) 183
GluI GCNGC 1 cut(s) 18
HaeIII GGCC 2 cut(s) 40, 108
HinfI GANTC 1 cut(s) 25
Hpy166II GTNNAC 1 cut(s) 116
Hpy188III TCNNGA 1 cut(s) 88
Hpy8I GTNNAC 1 cut(s) 116
HpyAV CCTTC 1 cut(s) 30
HpyCH4IV ACGT 1 cut(s) 118
HpyCH4V TGCA 2 cut(s) 17, 189
HpySE526I ACGT 1 cut(s) 118
Ksp22I TGATCA 1 cut(s) 84
Kzo9I GATC 1 cut(s) 84
Lsp1109I GCAGC 1 cut(s) 29
LweI GCATC 1 cut(s) 176
MaeI CTAG 1 cut(s) 183
MaeII ACGT 1 cut(s) 118
MalI GATC 1 cut(s) 86
MboI GATC 1 cut(s) 84
MboII GAAGA 1 cut(s) 17
MluCI AATT 3 cut(s) 60, 137, 168
MmeI TCCRAC 1 cut(s) 111
MseI TTAA 1 cut(s) 77
NdeII GATC 1 cut(s) 84
PceI AGGCCT 1 cut(s) 40
PfeI GAWTC 1 cut(s) 25
PkrI GCNGC 1 cut(s) 19
PspPI GGNCC 1 cut(s) 133
SaqAI TTAA 1 cut(s) 77
SatI GCNGC 1 cut(s) 18
Sau3AI GATC 1 cut(s) 84
Sau96I GGNCC 1 cut(s) 133
SetI ASST 2 cut(s) 121, 195
SfaNI GCATC 1 cut(s) 176
SgeI CNNG 6 cut(s) 54, 100, 105, 116, 195, 202
SinI GGWCC 1 cut(s) 133
Sse9I AATT 3 cut(s) 60, 137, 168
SseBI AGGCCT 1 cut(s) 40
SspMI CTAG 1 cut(s) 183
StuI AGGCCT 1 cut(s) 40
StyI CCWWGG 1 cut(s) 41
TaiI ACGT 1 cut(s) 121
TasI AATT 3 cut(s) 60, 137, 168
TfiI GAWTC 1 cut(s) 25
Tru1I TTAA 1 cut(s) 77
Tru9I TTAA 1 cut(s) 77
TscAI CASTG 1 cut(s) 27
TseI GCWGC 1 cut(s) 17
TspRI CASTG 1 cut(s) 27
VpaK11BI GGWCC 1 cut(s) 133
XmiI GTMKAC 1 cut(s) 115
XspI CTAG 1 cut(s) 183
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.