RchiOBHm_Chr1g0360411

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
52304882 .. 52308000
3119 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ58539

Sequence Viewer

Length: 171 bp
ATGGGAAAACTGCGGTTTAAAAGTAGTAAGAAGAGAGCTCAAGGACAGAAAGAAGCAGATTCTAGTCTAGTTGTTTCTTCAACTGGTACCTCTCCCTCAATCCCTGACAGAGCTGAAGAAGATGTCATTCAAGAAGGAGCTCCATCTTCCTCATCTGACAAGATCATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

56

Amino Acids

5.94

Weight (kDa)

8.1

Isoelectric Point (pI)

56.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 86
AccB1I GGYRCC 1 cut(s) 86
AciI CCGC 1 cut(s) 13
AcuI CTGAAG 1 cut(s) 135
AfaI GTAC 1 cut(s) 88
AgsI TTSAA 2 cut(s) 81, 131
AluBI AGCT 3 cut(s) 38, 113, 140
AluI AGCT 3 cut(s) 38, 113, 140
Alw21I GWGCWC 2 cut(s) 40, 142
Asp718I GGTACC 1 cut(s) 86
BanI GGYRCC 1 cut(s) 86
BanII GRGCYC 2 cut(s) 40, 142
Bbv12I GWGCWC 2 cut(s) 40, 142
BccI CCATC 1 cut(s) 151
BfaI CTAG 2 cut(s) 63, 68
BmiI GGNNCC 1 cut(s) 88
BpuEI CTTGAG 1 cut(s) 24
Bse1I ACTGG 1 cut(s) 88
BseNI ACTGG 1 cut(s) 88
BshNI GGYRCC 1 cut(s) 86
BsiHKAI GWGCWC 2 cut(s) 40, 142
Bsp1286I GDGCHC 2 cut(s) 40, 142
Bsp143I GATC 1 cut(s) 162
BspACI CCGC 1 cut(s) 13
BspLI GGNNCC 1 cut(s) 88
BspT107I GGYRCC 1 cut(s) 86
BsrI ACTGG 1 cut(s) 88
BssMI GATC 1 cut(s) 162
Bst6I CTCTTC 1 cut(s) 26
BstKTI GATC 1 cut(s) 165
BstMBI GATC 1 cut(s) 162
Csp6I GTAC 1 cut(s) 87
CviAII CATG 1 cut(s) 166
CviJI RGCY 3 cut(s) 38, 113, 140
CviKI_1 RGCY 3 cut(s) 38, 113, 140
CviQI GTAC 1 cut(s) 87
DpnI GATC 1 cut(s) 164
DpnII GATC 1 cut(s) 162
DraI TTTAAA 1 cut(s) 19
Eam1104I CTCTTC 1 cut(s) 26
EarI CTCTTC 1 cut(s) 26
Ecl136II GAGCTC 2 cut(s) 38, 140
Eco24I GRGCYC 2 cut(s) 40, 142
Eco53kI GAGCTC 2 cut(s) 38, 140
Eco57I CTGAAG 1 cut(s) 135
EcoICRI GAGCTC 2 cut(s) 38, 140
EcoT38I GRGCYC 2 cut(s) 40, 142
FaeI CATG 1 cut(s) 169
FaiI YATR 1 cut(s) 167
FatI CATG 1 cut(s) 165
FriOI GRGCYC 2 cut(s) 40, 142
FspBI CTAG 2 cut(s) 63, 68
Hin1II CATG 1 cut(s) 169
HinfI GANTC 1 cut(s) 59
Hpy188I TCNGA 1 cut(s) 157
Hpy188III TCNNGA 1 cut(s) 131
HpyAV CCTTC 1 cut(s) 128
Hsp92II CATG 1 cut(s) 169
KpnI GGTACC 1 cut(s) 90
Kzo9I GATC 1 cut(s) 162
LmnI GCTCC 2 cut(s) 137, 145
LpnPI CCDG 2 cut(s) 69, 117
MaeI CTAG 2 cut(s) 63, 68
MalI GATC 1 cut(s) 164
MboI GATC 1 cut(s) 162
MboII GAAGA 5 cut(s) 43, 69, 128, 131, 138
MhlI GDGCHC 2 cut(s) 40, 142
MnlI CCTC 3 cut(s) 100, 106, 160
MseI TTAA 1 cut(s) 18
NdeII GATC 1 cut(s) 162
NlaIII CATG 1 cut(s) 169
NlaIV GGNNCC 1 cut(s) 88
PfeI GAWTC 1 cut(s) 59
Psp124BI GAGCTC 2 cut(s) 40, 142
PspN4I GGNNCC 1 cut(s) 88
RsaI GTAC 1 cut(s) 88
RsaNI GTAC 1 cut(s) 87
SacI GAGCTC 2 cut(s) 40, 142
SaqAI TTAA 1 cut(s) 18
Sau3AI GATC 1 cut(s) 162
SduI GDGCHC 2 cut(s) 40, 142
SetI ASST 4 cut(s) 40, 92, 115, 142
SgeI CNNG 6 cut(s) 53, 75, 80, 96, 116, 143
SmlI CTYRAG 1 cut(s) 39
SmoI CTYRAG 1 cut(s) 39
SsiI CCGC 1 cut(s) 13
SspMI CTAG 2 cut(s) 63, 68
SstI GAGCTC 2 cut(s) 40, 142
TfiI GAWTC 1 cut(s) 59
Tru1I TTAA 1 cut(s) 18
Tru9I TTAA 1 cut(s) 18
XspI CTAG 2 cut(s) 63, 68
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.