RchiOBHm_Chr3g0479201

Zinc finger BED domain-containing protein RICESLEEPER

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
24996230 .. 24996607
378 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ44430

Sequence Viewer

Length: 168 bp
ATGATTAGGCACATAAACAACTCATGCAAGTATTATCCAGGAAGGAGGGTTGTCGATAAGAATCAGAAACTGCTTGTTGGTGATAAAAGTAAGGGTAATTCATTGAAGGCTGTAGCTTATAATCCTGACGAAGTGATGCAAGCTTGTGTTGAAATGGGTCCCCTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

55

Amino Acids

6.18

Weight (kDa)

9.34

Isoelectric Point (pI)

30.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 120
AgsI TTSAA 2 cut(s) 106, 152
AjnI CCWGG 1 cut(s) 37
AluBI AGCT 2 cut(s) 116, 143
AluI AGCT 2 cut(s) 116, 143
AlwNI CAGNNNCTG 1 cut(s) 70
AspS9I GGNCC 1 cut(s) 158
AsuHPI GGTGA 1 cut(s) 92
AvaII GGWCC 1 cut(s) 158
BciT130I CCWGG 1 cut(s) 39
BfmI CTRYAG 2 cut(s) 111, 164
Bme1390I CCNGG 1 cut(s) 39
Bme18I GGWCC 1 cut(s) 158
BmgT120I GGNCC 1 cut(s) 158
BmiI GGNNCC 2 cut(s) 159, 160
BmrFI CCNGG 1 cut(s) 39
BmsI GCATC 1 cut(s) 126
BsaBI GATNNNNATC 1 cut(s) 60
Bse8I GATNNNNATC 1 cut(s) 60
BseBI CCWGG 1 cut(s) 39
BseJI GATNNNNATC 1 cut(s) 60
BslFI GGGAC 1 cut(s) 144
BsmFI GGGAC 1 cut(s) 144
BspLI GGNNCC 2 cut(s) 159, 160
Bst2UI CCWGG 1 cut(s) 39
BstC8I GCNNGC 1 cut(s) 141
BstNI CCWGG 1 cut(s) 39
BstSCI CCNGG 1 cut(s) 37
BstSFI CTRYAG 2 cut(s) 111, 164
Cac8I GCNNGC 1 cut(s) 141
CaiI CAGNNNCTG 1 cut(s) 70
Cfr13I GGNCC 1 cut(s) 158
CviAII CATG 1 cut(s) 24
CviJI RGCY 3 cut(s) 110, 116, 143
CviKI_1 RGCY 3 cut(s) 110, 116, 143
Eco47I GGWCC 1 cut(s) 158
EcoO109I RGGNCCY 1 cut(s) 158
EcoRII CCWGG 1 cut(s) 37
FaeI CATG 1 cut(s) 27
FaiI YATR 3 cut(s) 14, 25, 120
FaqI GGGAC 1 cut(s) 144
FatI CATG 1 cut(s) 23
Hin1II CATG 1 cut(s) 27
HindIII AAGCTT 1 cut(s) 141
HinfI GANTC 1 cut(s) 61
HphI GGTGA 1 cut(s) 92
Hpy188I TCNGA 1 cut(s) 66
Hpy188III TCNNGA 1 cut(s) 125
HpyAV CCTTC 2 cut(s) 36, 100
HpyCH4V TGCA 2 cut(s) 27, 139
Hsp92II CATG 1 cut(s) 27
KflI GGGWCCC 1 cut(s) 158
LpnPI CCDG 3 cut(s) 24, 51, 138
LweI GCATC 1 cut(s) 126
MluCI AATT 1 cut(s) 97
MnlI CCTC 1 cut(s) 39
MspR9I CCNGG 1 cut(s) 39
MvaI CCWGG 1 cut(s) 39
NlaIII CATG 1 cut(s) 27
NlaIV GGNNCC 2 cut(s) 159, 160
PfeI GAWTC 1 cut(s) 61
PfoI TCCNGGA 1 cut(s) 37
PpuMI RGGWCCY 1 cut(s) 158
PsiI TTATAA 1 cut(s) 120
Psp5II RGGWCCY 1 cut(s) 158
Psp6I CCWGG 1 cut(s) 37
PspGI CCWGG 1 cut(s) 37
PspN4I GGNNCC 2 cut(s) 159, 160
PspPI GGNCC 1 cut(s) 158
PspPPI RGGWCCY 1 cut(s) 158
PstNI CAGNNNCTG 1 cut(s) 70
Sau96I GGNCC 1 cut(s) 158
ScrFI CCNGG 1 cut(s) 39
SetI ASST 2 cut(s) 118, 145
SfaNI GCATC 1 cut(s) 126
SfcI CTRYAG 2 cut(s) 111, 164
SgeI CNNG 8 cut(s) 36, 40, 50, 51, 86, 137, 152, 156
SinI GGWCC 1 cut(s) 158
Sse9I AATT 1 cut(s) 97
StyD4I CCNGG 1 cut(s) 37
TaqI TCGA 1 cut(s) 54
TasI AATT 1 cut(s) 97
TfiI GAWTC 1 cut(s) 61
TspDTI ATGAA 1 cut(s) 90
VpaK11BI GGWCC 1 cut(s) 158
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.