Rroxscaffold_2G00107450

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
31411836 .. 31416618
4783 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00107450.1

Sequence Viewer

Length: 282 bp
ATGAATAACCTTCTATCCTCACCACAGAGAACAACCATCACCATAGAGAACAACCTAAACCACTATGGCTTTTCATATCATTCAAATCCTCAACAGTACAACCAAGAAGAAAACAAGGCAATCACAATTCCAAACAAGTTTCTTGTAACCTCAGCCTCTTTAAGCTCTTGTCCTCCTCCAAAAGCTAAAGGAAAGAATGGCACCGAATCTGAAGATGAAGTTGTTGAAGTCAATGAAGATGGCTATGAAGAAATGATGTCTGATGATTCAAAAAACAGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

93

Amino Acids

10.39

Weight (kDa)

4.6

Isoelectric Point (pI)

66.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 200
AcuI CTGAAG 1 cut(s) 231
AfaI GTAC 1 cut(s) 98
AgsI TTSAA 3 cut(s) 84, 227, 270
AluBI AGCT 2 cut(s) 165, 185
AluI AGCT 2 cut(s) 165, 185
AsuHPI GGTGA 2 cut(s) 12, 31
BanI GGYRCC 1 cut(s) 200
BbvCI CCTCAGC 1 cut(s) 151
BccI CCATC 2 cut(s) 44, 233
BmiI GGNNCC 1 cut(s) 202
Bpu10I CCTNAGC 1 cut(s) 151
BseMII CTCAG 1 cut(s) 165
BseRI GAGGAG 1 cut(s) 165
BshNI GGYRCC 1 cut(s) 200
BspCNI CTCAG 1 cut(s) 164
BspLI GGNNCC 1 cut(s) 202
BspT107I GGYRCC 1 cut(s) 200
Bst4CI ACNGT 2 cut(s) 96, 278
BstDEI CTNAG 1 cut(s) 151
Csp6I GTAC 1 cut(s) 97
CviJI RGCY 5 cut(s) 69, 155, 165, 185, 243
CviKI_1 RGCY 5 cut(s) 69, 155, 165, 185, 243
CviQI GTAC 1 cut(s) 97
DdeI CTNAG 1 cut(s) 151
Eco57I CTGAAG 1 cut(s) 231
FaiI YATR 4 cut(s) 44, 66, 76, 246
HinfI GANTC 2 cut(s) 206, 266
HphI GGTGA 2 cut(s) 12, 31
Hpy188I TCNGA 2 cut(s) 211, 262
HpyAV CCTTC 1 cut(s) 20
HpyCH4III ACNGT 2 cut(s) 96, 278
HpyF3I CTNAG 1 cut(s) 151
MaeIII GTNAC 1 cut(s) 145
MboII GAAGA 4 cut(s) 119, 224, 248, 260
MluCI AATT 1 cut(s) 126
MnlI CCTC 6 cut(s) 28, 99, 160, 166, 183, 186
MseI TTAA 1 cut(s) 161
NlaIV GGNNCC 1 cut(s) 202
PfeI GAWTC 2 cut(s) 206, 266
PspN4I GGNNCC 1 cut(s) 202
RsaI GTAC 1 cut(s) 98
RsaNI GTAC 1 cut(s) 97
SaqAI TTAA 1 cut(s) 161
SetI ASST 5 cut(s) 12, 57, 152, 167, 187
SgeI CNNG 5 cut(s) 116, 127, 148, 155, 180
Sse9I AATT 1 cut(s) 126
TaaI ACNGT 2 cut(s) 96, 278
TasI AATT 1 cut(s) 126
TatI WGTACW 1 cut(s) 96
TfiI GAWTC 2 cut(s) 206, 266
Tru1I TTAA 1 cut(s) 161
Tru9I TTAA 1 cut(s) 161
TspDTI ATGAA 5 cut(s) 17, 63, 231, 249, 261
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.