Rroxscaffold_1G00009370

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
11807442 .. 11823842
16401 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00009370.1

Sequence Viewer

Length: 333 bp
ATGGAAATTAATCCGAAACCAGCCATAGCATTAGTCGAAGACTCGAAGGCTCTCGCTCTTCTCTCACTCCTCTCGCCCTCCTCGAAGATTCGAAAGCTCTCACTCTCCTCTCTACCTTCCATCGAGGAATCGATTCTTCAACTCGATTCTTCAAGCCTCCCACTCCGAATCGATGGGAAAACTGCGAATCATGTAACCTCAGCCTCTTCAACCTCTTGTCCTCCTCCAAAAGCTAAGGGAAAGAATGGTATTGGAACTAATGATGAAGTTGTTCAACTTAGTGAAGATGACTCCGAGGATGAAATGGTGTCCGATGATTCGGAAAACGGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

110

Amino Acids

11.55

Weight (kDa)

4.46

Isoelectric Point (pI)

62.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 4 cut(s) 140, 153, 210, 275
AluBI AGCT 2 cut(s) 97, 233
AluI AGCT 2 cut(s) 97, 233
AseI ATTAAT 1 cut(s) 9
Asp700I GAANNNNTTC 2 cut(s) 132, 270
AsuII TTCGAA 1 cut(s) 91
BbsI GAAGAC 1 cut(s) 45
BbvCI CCTCAGC 1 cut(s) 199
BccI CCATC 2 cut(s) 128, 167
BpiI GAAGAC 1 cut(s) 45
Bpu10I CCTNAGC 2 cut(s) 199, 234
Bpu14I TTCGAA 1 cut(s) 91
Bsa29I ATCGAT 2 cut(s) 131, 171
BsaJI CCNNGG 1 cut(s) 294
BseCI ATCGAT 2 cut(s) 131, 171
BseDI CCNNGG 1 cut(s) 294
BseGI GGATG 1 cut(s) 304
BseMII CTCAG 1 cut(s) 213
BseRI GAGGAG 4 cut(s) 59, 70, 97, 213
BshVI ATCGAT 2 cut(s) 131, 171
Bsp119I TTCGAA 1 cut(s) 91
BspCNI CTCAG 1 cut(s) 212
BspDI ATCGAT 2 cut(s) 131, 171
BspQI GCTCTTC 1 cut(s) 63
BspT104I TTCGAA 1 cut(s) 91
BssECI CCNNGG 1 cut(s) 294
Bst4CI ACNGT 1 cut(s) 329
Bst6I CTCTTC 2 cut(s) 63, 211
BstBI TTCGAA 1 cut(s) 91
BstDEI CTNAG 3 cut(s) 199, 234, 278
BstF5I GGATG 1 cut(s) 304
BstV2I GAAGAC 1 cut(s) 45
Bsu15I ATCGAT 2 cut(s) 131, 171
BsuTUI ATCGAT 2 cut(s) 131, 171
BtsCI GGATG 1 cut(s) 304
ClaI ATCGAT 2 cut(s) 131, 171
CviAII CATG 1 cut(s) 191
CviJI RGCY 6 cut(s) 23, 50, 97, 156, 203, 233
CviKI_1 RGCY 6 cut(s) 23, 50, 97, 156, 203, 233
DdeI CTNAG 3 cut(s) 199, 234, 278
Eam1104I CTCTTC 2 cut(s) 63, 211
EarI CTCTTC 2 cut(s) 63, 211
FaeI CATG 1 cut(s) 194
FaiI YATR 2 cut(s) 26, 192
FatI CATG 1 cut(s) 190
FokI GGATG 1 cut(s) 311
Hin1II CATG 1 cut(s) 194
HinfI GANTC 9 cut(s) 41, 88, 128, 133, 146, 168, 187, 290, 317
Hpy188I TCNGA 5 cut(s) 15, 167, 295, 313, 322
HpyAV CCTTC 2 cut(s) 40, 126
HpyCH4III ACNGT 1 cut(s) 329
HpyF3I CTNAG 3 cut(s) 199, 234, 278
Hsp92II CATG 1 cut(s) 194
LguI GCTCTTC 1 cut(s) 63
LpnPI CCDG 1 cut(s) 33
MaeIII GTNAC 1 cut(s) 193
MboII GAAGA 7 cut(s) 50, 50, 97, 128, 141, 198, 296
MluCI AATT 1 cut(s) 6
MlyI GAGTC 2 cut(s) 35, 284
MroXI GAANNNNTTC 2 cut(s) 132, 270
MseI TTAA 1 cut(s) 9
NlaIII CATG 1 cut(s) 194
NspV TTCGAA 1 cut(s) 91
PciSI GCTCTTC 1 cut(s) 63
PcsI WCGNNNNNNNCGW 1 cut(s) 80
PdmI GAANNNNTTC 2 cut(s) 132, 270
PfeI GAWTC 7 cut(s) 88, 128, 133, 146, 168, 187, 317
PleI GAGTC 2 cut(s) 35, 284
PpsI GAGTC 2 cut(s) 35, 284
PshBI ATTAAT 1 cut(s) 9
SapI GCTCTTC 1 cut(s) 63
SaqAI TTAA 1 cut(s) 9
SchI GAGTC 2 cut(s) 35, 284
SetI ASST 5 cut(s) 99, 118, 200, 215, 235
SfuI TTCGAA 1 cut(s) 91
Sse9I AATT 1 cut(s) 6
TaaI ACNGT 1 cut(s) 329
TaqI TCGA 8 cut(s) 36, 44, 83, 91, 123, 131, 144, 171
TasI AATT 1 cut(s) 6
TfiI GAWTC 7 cut(s) 88, 128, 133, 146, 168, 187, 317
Tru1I TTAA 1 cut(s) 9
Tru9I TTAA 1 cut(s) 9
TspDTI ATGAA 2 cut(s) 279, 315
VspI ATTAAT 1 cut(s) 9
XmnI GAANNNNTTC 2 cut(s) 132, 270
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.