Rh4BG427800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Reverse (-)
57146278 .. 57149935
3658 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG427800.1

Sequence Viewer

Length: 186 bp
ATGGGAAAACTGGGATTTAAAAGTGGTAAGAAGAAAGCTCAAGGACAGAAAGAAGGAGATTCTAGTCTAGTTGTTTCTTCAACTGCTAAGGGAAAGAATGGTATTGGAACTAATGATGAAGTTGTTCAACTCAGTGAAGATGACTCCGAGGATGAAATGAACTTGCTAGTTGCTACTGTGGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

61

Amino Acids

6.36

Weight (kDa)

4.89

Isoelectric Point (pI)

17.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 81, 128
AluBI AGCT 1 cut(s) 38
AluI AGCT 1 cut(s) 38
Asp700I GAANNNNTTC 1 cut(s) 123
BfaI CTAG 3 cut(s) 63, 68, 167
BmrI ACTGGG 1 cut(s) 20
BmuI ACTGGG 1 cut(s) 20
Bpu10I CCTNAGC 1 cut(s) 87
BpuEI CTTGAG 1 cut(s) 24
BsaJI CCNNGG 1 cut(s) 147
Bse1I ACTGG 1 cut(s) 15
BseDI CCNNGG 1 cut(s) 147
BseGI GGATG 1 cut(s) 157
BseMII CTCAG 1 cut(s) 145
BseNI ACTGG 1 cut(s) 15
BspCNI CTCAG 1 cut(s) 144
BsrI ACTGG 1 cut(s) 15
BssECI CCNNGG 1 cut(s) 147
Bst4CI ACNGT 1 cut(s) 178
BstDEI CTNAG 2 cut(s) 87, 131
BstF5I GGATG 1 cut(s) 157
BtsCI GGATG 1 cut(s) 157
BtsIMutI CAGTG 1 cut(s) 139
CviJI RGCY 1 cut(s) 38
CviKI_1 RGCY 1 cut(s) 38
DdeI CTNAG 2 cut(s) 87, 131
DraI TTTAAA 1 cut(s) 19
FokI GGATG 1 cut(s) 164
FspBI CTAG 3 cut(s) 63, 68, 167
HinfI GANTC 2 cut(s) 59, 143
Hpy188I TCNGA 1 cut(s) 148
HpyAV CCTTC 1 cut(s) 47
HpyCH4III ACNGT 1 cut(s) 178
HpyF3I CTNAG 2 cut(s) 87, 131
MaeI CTAG 3 cut(s) 63, 68, 167
MboII GAAGA 3 cut(s) 43, 69, 149
MlyI GAGTC 1 cut(s) 137
MnlI CCTC 1 cut(s) 142
MroXI GAANNNNTTC 1 cut(s) 123
MseI TTAA 2 cut(s) 18, 184
PdmI GAANNNNTTC 1 cut(s) 123
PfeI GAWTC 1 cut(s) 59
PleI GAGTC 1 cut(s) 137
PpsI GAGTC 1 cut(s) 137
SaqAI TTAA 2 cut(s) 18, 184
SchI GAGTC 1 cut(s) 137
SetI ASST 1 cut(s) 40
SgeI CNNG 7 cut(s) 23, 53, 75, 80, 160, 175, 179
SmlI CTYRAG 1 cut(s) 39
SmoI CTYRAG 1 cut(s) 39
SspMI CTAG 3 cut(s) 63, 68, 167
TaaI ACNGT 1 cut(s) 178
TfiI GAWTC 1 cut(s) 59
Tru1I TTAA 2 cut(s) 18, 184
Tru9I TTAA 2 cut(s) 18, 184
TscAI CASTG 1 cut(s) 139
TspDTI ATGAA 3 cut(s) 132, 168, 173
TspRI CASTG 1 cut(s) 139
XmnI GAANNNNTTC 1 cut(s) 123
XspI CTAG 3 cut(s) 63, 68, 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.