RchiOBHm_Chr5g0071091

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
77054638 .. 77056143
1506 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ34625

Sequence Viewer

Length: 198 bp
ATGGGAAAACTGCGATTTAAAAGCAGTAAGAAGAAAGCTCAAGGACAGAAAGAAGGAGATTCTAGTGTAGTTGTTTCTTTAACTGGTACCTCTCCCTCAATCCTTGACAGAGCTGAAGAAGATGTCACGAATGGAGGAGCTCCAGCTTCCTCATCTGACAAGGTTAGTAACAATCCTCGAGCTGATAGAAAAACGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

6.81

Weight (kDa)

9.77

Isoelectric Point (pI)

33.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 86
AccB1I GGYRCC 1 cut(s) 86
AcuI CTGAAG 1 cut(s) 135
AfaI GTAC 1 cut(s) 88
AluBI AGCT 5 cut(s) 38, 113, 140, 146, 182
AluI AGCT 5 cut(s) 38, 113, 140, 146, 182
Alw21I GWGCWC 1 cut(s) 142
Ama87I CYCGRG 1 cut(s) 177
Asp718I GGTACC 1 cut(s) 86
AvaI CYCGRG 1 cut(s) 177
BanI GGYRCC 1 cut(s) 86
BanII GRGCYC 1 cut(s) 142
Bbv12I GWGCWC 1 cut(s) 142
BfaI CTAG 1 cut(s) 63
BmeT110I CYCGRG 1 cut(s) 177
BmiI GGNNCC 1 cut(s) 88
BpmI CTGGAG 1 cut(s) 126
BpuEI CTTGAG 1 cut(s) 24
Bse1I ACTGG 1 cut(s) 88
BseNI ACTGG 1 cut(s) 88
BseRI GAGGAG 1 cut(s) 150
BshNI GGYRCC 1 cut(s) 86
BsiHKAI GWGCWC 1 cut(s) 142
BsiHKCI CYCGRG 1 cut(s) 177
BsoBI CYCGRG 1 cut(s) 177
Bsp1286I GDGCHC 1 cut(s) 142
BspLI GGNNCC 1 cut(s) 88
BspT107I GGYRCC 1 cut(s) 86
BsrI ACTGG 1 cut(s) 88
Csp6I GTAC 1 cut(s) 87
CviJI RGCY 5 cut(s) 38, 113, 140, 146, 182
CviKI_1 RGCY 5 cut(s) 38, 113, 140, 146, 182
CviQI GTAC 1 cut(s) 87
DraI TTTAAA 1 cut(s) 19
Ecl136II GAGCTC 1 cut(s) 140
Eco24I GRGCYC 1 cut(s) 142
Eco53kI GAGCTC 1 cut(s) 140
Eco57I CTGAAG 1 cut(s) 135
Eco88I CYCGRG 1 cut(s) 177
EcoICRI GAGCTC 1 cut(s) 140
EcoT38I GRGCYC 1 cut(s) 142
FriOI GRGCYC 1 cut(s) 142
FspBI CTAG 1 cut(s) 63
GsuI CTGGAG 1 cut(s) 126
HinfI GANTC 1 cut(s) 59
Hpy188I TCNGA 1 cut(s) 157
Hpy188III TCNNGA 1 cut(s) 127
HpyAV CCTTC 1 cut(s) 47
HpyCH4IV ACGT 1 cut(s) 194
HpySE526I ACGT 1 cut(s) 194
KpnI GGTACC 1 cut(s) 90
LmnI GCTCC 2 cut(s) 137, 145
LpnPI CCDG 2 cut(s) 69, 156
MaeI CTAG 1 cut(s) 63
MaeII ACGT 1 cut(s) 194
MaeIII GTNAC 2 cut(s) 124, 167
MboII GAAGA 3 cut(s) 43, 128, 131
MhlI GDGCHC 1 cut(s) 142
MnlI CCTC 5 cut(s) 100, 106, 128, 160, 186
MseI TTAA 2 cut(s) 18, 80
NlaIV GGNNCC 1 cut(s) 88
NmuCI GTSAC 1 cut(s) 124
PaeR7I CTCGAG 1 cut(s) 177
PfeI GAWTC 1 cut(s) 59
Psp124BI GAGCTC 1 cut(s) 142
PspN4I GGNNCC 1 cut(s) 88
PspXI VCTCGAGB 1 cut(s) 177
RsaI GTAC 1 cut(s) 88
RsaNI GTAC 1 cut(s) 87
SacI GAGCTC 1 cut(s) 142
SaqAI TTAA 2 cut(s) 18, 80
SduI GDGCHC 1 cut(s) 142
SetI ASST 8 cut(s) 40, 92, 115, 142, 148, 165, 184, 197
Sfr274I CTCGAG 1 cut(s) 177
SgeI CNNG 9 cut(s) 53, 75, 96, 116, 139, 155, 172, 189, 191
SlaI CTCGAG 1 cut(s) 177
SmlI CTYRAG 2 cut(s) 39, 177
SmoI CTYRAG 2 cut(s) 39, 177
SspMI CTAG 1 cut(s) 63
SstI GAGCTC 1 cut(s) 142
TaiI ACGT 1 cut(s) 197
TaqI TCGA 1 cut(s) 178
TfiI GAWTC 1 cut(s) 59
Tru1I TTAA 2 cut(s) 18, 80
Tru9I TTAA 2 cut(s) 18, 80
TseFI GTSAC 1 cut(s) 124
Tsp45I GTSAC 1 cut(s) 124
XhoI CTCGAG 1 cut(s) 177
XspI CTAG 1 cut(s) 63
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.