RchiOBHm_Chr1g0368651

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
58682578 .. 58683248
671 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ59298

Sequence Viewer

Length: 153 bp
ATGAGAAAACTTGCTGCATTACTTAGGGATGAAGATCATGAGATAGAAGACCTTACTTTGCCTTCCCATACTGATGCAGCATTGGACATTGATGATTGTGATGATATTCATGTGGGTGTGGATGGATATGATGATTATGAATTGGAAGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

50

Amino Acids

5.7

Weight (kDa)

4.05

Isoelectric Point (pI)

46.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
ApeKI GCWGC 2 cut(s) 14, 77
BbsI GAAGAC 1 cut(s) 54
BbvI GCAGC 1 cut(s) 89
BccI CCATC 1 cut(s) 116
BisI GCNGC 2 cut(s) 15, 78
BlsI GCNGC 2 cut(s) 16, 79
BmsI GCATC 1 cut(s) 64
BpiI GAAGAC 1 cut(s) 54
BsaBI GATNNNNATC 1 cut(s) 33
Bse8I GATNNNNATC 1 cut(s) 33
BseGI GGATG 2 cut(s) 34, 127
BseJI GATNNNNATC 1 cut(s) 33
BseXI GCAGC 1 cut(s) 89
Bsp143I GATC 1 cut(s) 34
BspHI TCATGA 1 cut(s) 37
BssMI GATC 1 cut(s) 34
BstDEI CTNAG 1 cut(s) 23
BstF5I GGATG 2 cut(s) 34, 127
BstKTI GATC 1 cut(s) 37
BstMBI GATC 1 cut(s) 34
BstV1I GCAGC 1 cut(s) 89
BstV2I GAAGAC 1 cut(s) 54
BtsCI GGATG 2 cut(s) 34, 127
CciI TCATGA 1 cut(s) 37
CviAII CATG 2 cut(s) 38, 110
DdeI CTNAG 1 cut(s) 23
DpnI GATC 1 cut(s) 36
DpnII GATC 1 cut(s) 34
FaeI CATG 2 cut(s) 41, 113
FaiI YATR 5 cut(s) 39, 69, 111, 129, 138
FatI CATG 2 cut(s) 37, 109
Fnu4HI GCNGC 2 cut(s) 15, 78
FokI GGATG 2 cut(s) 41, 134
Fsp4HI GCNGC 2 cut(s) 15, 78
GluI GCNGC 2 cut(s) 15, 78
Hin1II CATG 2 cut(s) 41, 113
Hpy188III TCNNGA 1 cut(s) 38
HpyAV CCTTC 1 cut(s) 72
HpyCH4V TGCA 2 cut(s) 17, 77
HpyF3I CTNAG 1 cut(s) 23
Hsp92II CATG 2 cut(s) 41, 113
Kzo9I GATC 1 cut(s) 34
Lsp1109I GCAGC 1 cut(s) 89
LweI GCATC 1 cut(s) 64
MalI GATC 1 cut(s) 36
MboI GATC 1 cut(s) 34
MboII GAAGA 2 cut(s) 44, 59
MluCI AATT 1 cut(s) 140
MslI CAYNNNNRTG 2 cut(s) 72, 114
NdeII GATC 1 cut(s) 34
NlaIII CATG 2 cut(s) 41, 113
PagI TCATGA 1 cut(s) 37
PkrI GCNGC 2 cut(s) 16, 79
RseI CAYNNNNRTG 2 cut(s) 72, 114
SatI GCNGC 2 cut(s) 15, 78
Sau3AI GATC 1 cut(s) 34
SetI ASST 1 cut(s) 54
SfaNI GCATC 1 cut(s) 64
SgeI CNNG 3 cut(s) 23, 50, 122
SmiMI CAYNNNNRTG 2 cut(s) 72, 114
Sse9I AATT 1 cut(s) 140
TasI AATT 1 cut(s) 140
TseI GCWGC 2 cut(s) 14, 77
TspDTI ATGAA 3 cut(s) 45, 98, 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.