Rh7DG300700

Protein of unknown function (DUF 659)

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Reverse (-)
34451681 .. 34455807
4127 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG300700.1

Sequence Viewer

Length: 267 bp
ATGGAAGAGGAGAGATACTTTAGATGTGTATTTCGTAATCAAGTATGCAGTACCACTATATCAAGACTTAAGCATCATTTAGCAGGTGTTGCGGGTGGTATGAAATCATGTAATAAAGTCCCTGCAGATGTGAAGAAAGAGGATGAAGATGATGAGATAGAAGACCTTACTTTGCCTCCACACACTGATACAGCATTGAACATTGATGATTGTGATGACATTCAAGTGGGTATGGATGGATATGATGATTATGATTTGGAAGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

88

Amino Acids

10.01

Weight (kDa)

4.3

Isoelectric Point (pI)

55.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 74
Acc36I ACCTGC 1 cut(s) 74
AciI CCGC 1 cut(s) 92
AfaI GTAC 1 cut(s) 52
AflII CTTAAG 1 cut(s) 68
AgsI TTSAA 2 cut(s) 199, 224
BbsI GAAGAC 1 cut(s) 168
BccI CCATC 1 cut(s) 230
BfmI CTRYAG 1 cut(s) 123
BfrI CTTAAG 1 cut(s) 68
BfuAI ACCTGC 1 cut(s) 74
BmsI GCATC 1 cut(s) 82
BpiI GAAGAC 1 cut(s) 168
BsaXI ACNNNNNCTCC 2 cut(s) 160, 190
BseGI GGATG 2 cut(s) 148, 241
BseRI GAGGAG 1 cut(s) 23
BslFI GGGAC 1 cut(s) 104
BsmFI GGGAC 1 cut(s) 104
BspACI CCGC 1 cut(s) 92
BspMAI CTGCAG 1 cut(s) 127
BspMI ACCTGC 1 cut(s) 74
BspTI CTTAAG 1 cut(s) 68
BstAFI CTTAAG 1 cut(s) 68
BstAPI GCANNNNNTGC 1 cut(s) 89
BstF5I GGATG 2 cut(s) 148, 241
BstMWI GCNNNNNNNGC 1 cut(s) 89
BstSFI CTRYAG 1 cut(s) 123
BstV2I GAAGAC 1 cut(s) 168
BtsCI GGATG 2 cut(s) 148, 241
BtsIMutI CAGTG 1 cut(s) 183
BveI ACCTGC 1 cut(s) 74
Csp6I GTAC 1 cut(s) 51
CviAII CATG 1 cut(s) 108
CviQI GTAC 1 cut(s) 51
FaeI CATG 1 cut(s) 111
FaiI YATR 7 cut(s) 46, 59, 101, 109, 233, 243, 252
FaqI GGGAC 1 cut(s) 104
FatI CATG 1 cut(s) 107
FauI CCCGC 1 cut(s) 85
FokI GGATG 2 cut(s) 155, 248
Hin1II CATG 1 cut(s) 111
Hpy188III TCNNGA 1 cut(s) 63
HpyCH4V TGCA 2 cut(s) 48, 125
HpyF10VI GCNNNNNNNGC 1 cut(s) 89
Hsp92II CATG 1 cut(s) 111
LpnPI CCDG 2 cut(s) 69, 135
LweI GCATC 1 cut(s) 82
MboII GAAGA 4 cut(s) 17, 145, 158, 173
MnlI CCTC 2 cut(s) 133, 186
MseI TTAA 1 cut(s) 69
MslI CAYNNNNRTG 1 cut(s) 224
MspCI CTTAAG 1 cut(s) 68
MwoI GCNNNNNNNGC 1 cut(s) 89
NlaIII CATG 1 cut(s) 111
PaqCI CACCTGC 1 cut(s) 74
PstI CTGCAG 1 cut(s) 127
RsaI GTAC 1 cut(s) 52
RsaNI GTAC 1 cut(s) 51
RseI CAYNNNNRTG 1 cut(s) 224
SaqAI TTAA 1 cut(s) 69
SetI ASST 2 cut(s) 88, 168
SfaNI GCATC 1 cut(s) 82
SfcI CTRYAG 1 cut(s) 123
SgeI CNNG 7 cut(s) 53, 75, 96, 105, 120, 134, 236
SmiMI CAYNNNNRTG 1 cut(s) 224
SmlI CTYRAG 1 cut(s) 68
SmoI CTYRAG 1 cut(s) 68
SsiI CCGC 1 cut(s) 92
Tru1I TTAA 1 cut(s) 69
Tru9I TTAA 1 cut(s) 69
TscAI CASTG 1 cut(s) 190
TspDTI ATGAA 2 cut(s) 116, 159
TspRI CASTG 1 cut(s) 190
Vha464I CTTAAG 1 cut(s) 68
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.