Rh5BG265300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Reverse (-)
33185469 .. 33185997
529 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG265300.1

Sequence Viewer

Length: 204 bp
ATGGCTGCTGCACAATCAATTGCTAATGGTAAGGTAAGATCCATGCAGAAAATGAGAAAACTTGCTGCATTACTTAGGGATGAAGATGATGAGATAGAAGACCTTACTTTGCCTCCCTACACTCATGCAGCATTGATCAGTGATGATTGTAATGATATTAATGTGGGTGTGGATGGATATGATGACTATGATTTGGAAGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.44

Weight (kDa)

4.15

Isoelectric Point (pI)

51.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 33
AlwI GGATC 1 cut(s) 33
ApeKI GCWGC 4 cut(s) 5, 8, 65, 128
AseI ATTAAT 1 cut(s) 159
BbsI GAAGAC 1 cut(s) 105
BbvI GCAGC 2 cut(s) 52, 140
BccI CCATC 1 cut(s) 167
BclI TGATCA 1 cut(s) 135
BisI GCNGC 4 cut(s) 6, 9, 66, 129
BlsI GCNGC 4 cut(s) 7, 10, 67, 130
BpiI GAAGAC 1 cut(s) 105
BsaXI ACNNNNNCTCC 2 cut(s) 97, 127
BseGI GGATG 2 cut(s) 85, 178
BseXI GCAGC 2 cut(s) 52, 140
Bsp143I GATC 2 cut(s) 38, 135
BspPI GGATC 1 cut(s) 33
BssMI GATC 2 cut(s) 38, 135
BstDEI CTNAG 1 cut(s) 74
BstF5I GGATG 2 cut(s) 85, 178
BstKTI GATC 2 cut(s) 41, 138
BstMBI GATC 2 cut(s) 38, 135
BstV1I GCAGC 2 cut(s) 52, 140
BstV2I GAAGAC 1 cut(s) 105
BstX2I RGATCY 1 cut(s) 38
BstYI RGATCY 1 cut(s) 38
BtsCI GGATG 2 cut(s) 85, 178
BtsIMutI CAGTG 1 cut(s) 145
CviAII CATG 2 cut(s) 43, 125
CviJI RGCY 1 cut(s) 5
CviKI_1 RGCY 1 cut(s) 5
DdeI CTNAG 1 cut(s) 74
DpnI GATC 2 cut(s) 40, 137
DpnII GATC 2 cut(s) 38, 135
FaeI CATG 2 cut(s) 46, 128
FaiI YATR 4 cut(s) 44, 126, 180, 189
FatI CATG 2 cut(s) 42, 124
FbaI TGATCA 1 cut(s) 135
Fnu4HI GCNGC 4 cut(s) 6, 9, 66, 129
FokI GGATG 2 cut(s) 92, 185
Fsp4HI GCNGC 4 cut(s) 6, 9, 66, 129
GluI GCNGC 4 cut(s) 6, 9, 66, 129
Hin1II CATG 2 cut(s) 46, 128
HpyCH4V TGCA 4 cut(s) 11, 46, 68, 128
HpyF3I CTNAG 1 cut(s) 74
Hsp92II CATG 2 cut(s) 46, 128
Ksp22I TGATCA 1 cut(s) 135
Kzo9I GATC 2 cut(s) 38, 135
Lsp1109I GCAGC 2 cut(s) 52, 140
MalI GATC 2 cut(s) 40, 137
MboI GATC 2 cut(s) 38, 135
MboII GAAGA 2 cut(s) 95, 110
MfeI CAATTG 1 cut(s) 18
MflI RGATCY 1 cut(s) 38
MluCI AATT 1 cut(s) 18
MnlI CCTC 1 cut(s) 123
MseI TTAA 1 cut(s) 159
MunI CAATTG 1 cut(s) 18
NdeII GATC 2 cut(s) 38, 135
NlaIII CATG 2 cut(s) 46, 128
PkrI GCNGC 4 cut(s) 7, 10, 67, 130
PshBI ATTAAT 1 cut(s) 159
PsuI RGATCY 1 cut(s) 38
SaqAI TTAA 1 cut(s) 159
SatI GCNGC 4 cut(s) 6, 9, 66, 129
Sau3AI GATC 2 cut(s) 38, 135
SetI ASST 2 cut(s) 36, 105
SgeI CNNG 3 cut(s) 55, 74, 137
Sse9I AATT 1 cut(s) 18
TasI AATT 1 cut(s) 18
Tru1I TTAA 1 cut(s) 159
Tru9I TTAA 1 cut(s) 159
TscAI CASTG 1 cut(s) 145
TseI GCWGC 4 cut(s) 5, 8, 65, 128
TspDTI ATGAA 1 cut(s) 96
TspRI CASTG 1 cut(s) 145
VspI ATTAAT 1 cut(s) 159
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.