RchiOBHm_Chr1g0382201

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
67216609 .. 67217619
1011 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ60520

Sequence Viewer

Length: 156 bp
ATGAGAAAACTTGCTGCATTAATACTTAGGGATGAAGATGATGAGATAGAAGACCTTACTTTGCCTCCCTACACTGATGCAGCATTGATCAGTGATGATTGTAATGATATTAATGTGGGTGTGGATGCATATGATGACTATGATTTGGAAGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

5.78

Weight (kDa)

4.05

Isoelectric Point (pI)

51.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
ApeKI GCWGC 2 cut(s) 14, 80
AseI ATTAAT 2 cut(s) 20, 111
BbsI GAAGAC 1 cut(s) 57
BbvI GCAGC 1 cut(s) 92
BclI TGATCA 1 cut(s) 87
BisI GCNGC 2 cut(s) 15, 81
BlsI GCNGC 2 cut(s) 16, 82
BmsI GCATC 2 cut(s) 67, 115
BpiI GAAGAC 1 cut(s) 57
BsaXI ACNNNNNCTCC 2 cut(s) 49, 79
BseGI GGATG 2 cut(s) 37, 130
BseXI GCAGC 1 cut(s) 92
Bsp143I GATC 1 cut(s) 87
BssMI GATC 1 cut(s) 87
BstDEI CTNAG 1 cut(s) 26
BstF5I GGATG 2 cut(s) 37, 130
BstKTI GATC 1 cut(s) 90
BstMBI GATC 1 cut(s) 87
BstV1I GCAGC 1 cut(s) 92
BstV2I GAAGAC 1 cut(s) 57
BtsCI GGATG 2 cut(s) 37, 130
BtsIMutI CAGTG 2 cut(s) 72, 97
DdeI CTNAG 1 cut(s) 26
DpnI GATC 1 cut(s) 89
DpnII GATC 1 cut(s) 87
EcoT22I ATGCAT 1 cut(s) 130
FaiI YATR 3 cut(s) 130, 132, 141
FauNDI CATATG 1 cut(s) 130
FbaI TGATCA 1 cut(s) 87
Fnu4HI GCNGC 2 cut(s) 15, 81
FokI GGATG 2 cut(s) 44, 137
Fsp4HI GCNGC 2 cut(s) 15, 81
GluI GCNGC 2 cut(s) 15, 81
HpyCH4V TGCA 3 cut(s) 17, 80, 128
HpyF3I CTNAG 1 cut(s) 26
Ksp22I TGATCA 1 cut(s) 87
Kzo9I GATC 1 cut(s) 87
Lsp1109I GCAGC 1 cut(s) 92
LweI GCATC 2 cut(s) 67, 115
MalI GATC 1 cut(s) 89
MboI GATC 1 cut(s) 87
MboII GAAGA 2 cut(s) 47, 62
MnlI CCTC 1 cut(s) 75
Mph1103I ATGCAT 1 cut(s) 130
MseI TTAA 2 cut(s) 20, 111
NdeI CATATG 1 cut(s) 130
NdeII GATC 1 cut(s) 87
NsiI ATGCAT 1 cut(s) 130
PkrI GCNGC 2 cut(s) 16, 82
PshBI ATTAAT 2 cut(s) 20, 111
SaqAI TTAA 2 cut(s) 20, 111
SatI GCNGC 2 cut(s) 15, 81
Sau3AI GATC 1 cut(s) 87
SetI ASST 1 cut(s) 57
SfaNI GCATC 2 cut(s) 67, 115
SgeI CNNG 1 cut(s) 23
Tru1I TTAA 2 cut(s) 20, 111
Tru9I TTAA 2 cut(s) 20, 111
TscAI CASTG 2 cut(s) 79, 97
TseI GCWGC 2 cut(s) 14, 80
TspDTI ATGAA 1 cut(s) 48
TspRI CASTG 2 cut(s) 79, 97
VspI ATTAAT 2 cut(s) 20, 111
Zsp2I ATGCAT 1 cut(s) 130
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.