RchiOBHm_Chr1g0377971

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
64624036 .. 64627310
3275 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ60141

Sequence Viewer

Length: 153 bp
ATGAGAAAACTTGCTGCATTACTTATGGATGAAGATGATGAGATAGAAGACCTTACTTTGCCTCCCTACACTCATGCAGCATTGATCAATGATGATTGTAATGATATTAATGTGGGTGTGGATGGATATGATGACTATGATTTGGAAGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

50

Amino Acids

5.67

Weight (kDa)

4.05

Isoelectric Point (pI)

42.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
ApeKI GCWGC 2 cut(s) 14, 77
AseI ATTAAT 1 cut(s) 108
BbsI GAAGAC 1 cut(s) 54
BbvI GCAGC 1 cut(s) 89
BccI CCATC 1 cut(s) 116
BclI TGATCA 1 cut(s) 84
BisI GCNGC 2 cut(s) 15, 78
BlsI GCNGC 2 cut(s) 16, 79
BpiI GAAGAC 1 cut(s) 54
BsaXI ACNNNNNCTCC 2 cut(s) 46, 76
BseGI GGATG 2 cut(s) 34, 127
BseXI GCAGC 1 cut(s) 89
Bsp143I GATC 1 cut(s) 84
BssMI GATC 1 cut(s) 84
BstF5I GGATG 2 cut(s) 34, 127
BstKTI GATC 1 cut(s) 87
BstMBI GATC 1 cut(s) 84
BstV1I GCAGC 1 cut(s) 89
BstV2I GAAGAC 1 cut(s) 54
BtsCI GGATG 2 cut(s) 34, 127
CviAII CATG 1 cut(s) 74
DpnI GATC 1 cut(s) 86
DpnII GATC 1 cut(s) 84
FaeI CATG 1 cut(s) 77
FaiI YATR 4 cut(s) 26, 75, 129, 138
FatI CATG 1 cut(s) 73
FbaI TGATCA 1 cut(s) 84
Fnu4HI GCNGC 2 cut(s) 15, 78
FokI GGATG 2 cut(s) 41, 134
Fsp4HI GCNGC 2 cut(s) 15, 78
GluI GCNGC 2 cut(s) 15, 78
Hin1II CATG 1 cut(s) 77
HpyCH4V TGCA 2 cut(s) 17, 77
Hsp92II CATG 1 cut(s) 77
Ksp22I TGATCA 1 cut(s) 84
Kzo9I GATC 1 cut(s) 84
Lsp1109I GCAGC 1 cut(s) 89
MalI GATC 1 cut(s) 86
MboI GATC 1 cut(s) 84
MboII GAAGA 2 cut(s) 44, 59
MnlI CCTC 1 cut(s) 72
MseI TTAA 1 cut(s) 108
NdeII GATC 1 cut(s) 84
NlaIII CATG 1 cut(s) 77
PkrI GCNGC 2 cut(s) 16, 79
PshBI ATTAAT 1 cut(s) 108
SaqAI TTAA 1 cut(s) 108
SatI GCNGC 2 cut(s) 15, 78
Sau3AI GATC 1 cut(s) 84
SetI ASST 1 cut(s) 54
SgeI CNNG 2 cut(s) 23, 86
Tru1I TTAA 1 cut(s) 108
Tru9I TTAA 1 cut(s) 108
TseI GCWGC 2 cut(s) 14, 77
TspDTI ATGAA 1 cut(s) 45
VspI ATTAAT 1 cut(s) 108
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.