Rroxscaffold_3G00236920

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Forward (+)
24392024 .. 24392336
313 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00236920.1

Sequence Viewer

Length: 225 bp
ATGCTGCTTATTCACCTTCTCCTAAAAGAAAAAAATGATGAAAGCTCAAGTAAGGTAAGATCCAAGAAGAAAATGAGAAAACTTGCTGCATTACTTAGGGATGAAGATCATGAGATAGAAGACCTTACTTTGCCTCCCCACACTGATGCAACATTGGACATTGATGATTGTGATGATATTCATGTGGGTGTGGATGGATATGATGATTATGAATTGGAAGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

74

Amino Acids

8.55

Weight (kDa)

4.56

Isoelectric Point (pI)

52.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 54
AluBI AGCT 1 cut(s) 45
AluI AGCT 1 cut(s) 45
AlwI GGATC 1 cut(s) 54
ApeKI GCWGC 2 cut(s) 4, 86
AsuHPI GGTGA 1 cut(s) 5
BbsI GAAGAC 1 cut(s) 126
BbvI GCAGC 1 cut(s) 73
BccI CCATC 1 cut(s) 188
BisI GCNGC 2 cut(s) 5, 87
BlsI GCNGC 2 cut(s) 6, 88
BmsI GCATC 1 cut(s) 136
BpiI GAAGAC 1 cut(s) 126
BpuEI CTTGAG 1 cut(s) 31
BsaBI GATNNNNATC 1 cut(s) 105
BsaXI ACNNNNNCTCC 2 cut(s) 118, 148
Bse8I GATNNNNATC 1 cut(s) 105
BseGI GGATG 2 cut(s) 106, 199
BseJI GATNNNNATC 1 cut(s) 105
BseXI GCAGC 1 cut(s) 73
Bsp143I GATC 2 cut(s) 59, 106
BspHI TCATGA 1 cut(s) 109
BspPI GGATC 1 cut(s) 54
BssMI GATC 2 cut(s) 59, 106
BstDEI CTNAG 1 cut(s) 95
BstF5I GGATG 2 cut(s) 106, 199
BstKTI GATC 2 cut(s) 62, 109
BstMBI GATC 2 cut(s) 59, 106
BstV1I GCAGC 1 cut(s) 73
BstV2I GAAGAC 1 cut(s) 126
BstX2I RGATCY 1 cut(s) 59
BstYI RGATCY 1 cut(s) 59
BtsCI GGATG 2 cut(s) 106, 199
BtsIMutI CAGTG 1 cut(s) 141
CciI TCATGA 1 cut(s) 109
CviAII CATG 2 cut(s) 110, 182
CviJI RGCY 1 cut(s) 45
CviKI_1 RGCY 1 cut(s) 45
DdeI CTNAG 1 cut(s) 95
DpnI GATC 2 cut(s) 61, 108
DpnII GATC 2 cut(s) 59, 106
FaeI CATG 2 cut(s) 113, 185
FaiI YATR 4 cut(s) 111, 183, 201, 210
FatI CATG 2 cut(s) 109, 181
Fnu4HI GCNGC 2 cut(s) 5, 87
FokI GGATG 2 cut(s) 113, 206
Fsp4HI GCNGC 2 cut(s) 5, 87
GluI GCNGC 2 cut(s) 5, 87
Hin1II CATG 2 cut(s) 113, 185
HphI GGTGA 1 cut(s) 5
Hpy188III TCNNGA 1 cut(s) 110
HpyAV CCTTC 1 cut(s) 26
HpyCH4V TGCA 2 cut(s) 89, 149
HpyF3I CTNAG 1 cut(s) 95
Hsp92II CATG 2 cut(s) 113, 185
Kzo9I GATC 2 cut(s) 59, 106
Lsp1109I GCAGC 1 cut(s) 73
LweI GCATC 1 cut(s) 136
MalI GATC 2 cut(s) 61, 108
MboI GATC 2 cut(s) 59, 106
MboII GAAGA 3 cut(s) 79, 116, 131
MflI RGATCY 1 cut(s) 59
MluCI AATT 1 cut(s) 212
MnlI CCTC 1 cut(s) 144
MslI CAYNNNNRTG 2 cut(s) 144, 186
NdeII GATC 2 cut(s) 59, 106
NlaIII CATG 2 cut(s) 113, 185
PagI TCATGA 1 cut(s) 109
PkrI GCNGC 2 cut(s) 6, 88
PsuI RGATCY 1 cut(s) 59
RseI CAYNNNNRTG 2 cut(s) 144, 186
SatI GCNGC 2 cut(s) 5, 87
Sau3AI GATC 2 cut(s) 59, 106
SetI ASST 4 cut(s) 18, 47, 57, 126
SfaNI GCATC 1 cut(s) 136
SgeI CNNG 5 cut(s) 60, 76, 95, 122, 194
SmiMI CAYNNNNRTG 2 cut(s) 144, 186
SmlI CTYRAG 1 cut(s) 46
SmoI CTYRAG 1 cut(s) 46
Sse9I AATT 1 cut(s) 212
TasI AATT 1 cut(s) 212
TscAI CASTG 1 cut(s) 148
TseI GCWGC 2 cut(s) 4, 86
TspDTI ATGAA 4 cut(s) 54, 117, 170, 225
TspRI CASTG 1 cut(s) 148
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.