Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0013751

Physical Location & Seq

Genomic Coordinates Forward (+)

61019983 .. 61023803

Gene Structure 3821 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ59627

Sequence Viewer

CDS Protein Promoter (2k)

Length: 132 bp

ATGGGTATTACTGAAGCATTGCGATTGCAGGTAGAACTCCAAAAGCGGCTTCATGAACAACTTGAGCGTGACCGATTTTTTCTGGATAGATTGGAGTGCAAGGTCAAACAAAATAGTTACTTCATCTCATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

43

Amino Acids

5.28

Weight (kDa)

7.94

Isoelectric Point (pI)

51.79

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Myb_CC_LHEQLE	PF14379	1 - 25	9.8e-10	MYB-CC type transfactor, LHEQLE motif

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013751)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0341161 RchiOBHm_Chr1g0372271 RchiOBHm_Chr5g0016161 RchiOBHm_Chr5g0035391
rosa_laevigata	RLG00000023276 RLG00000028206
rosa_multiflora	Rmu_co8303235.1_g000001
rosa_roxburghii	Rroxscaffold_1G00057450 Rroxscaffold_7G00210970
rosa_rugosa	Rorug03G0205900 Rorug03G0206200 Rorug03G0343100 Rorug04G0385400 Rorug04G0385500
rosa_samantha	Rh2AG140100 Rh3AG019500 Rh4AG146100 Rh5AG085400

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	19
AciI	CCGC	1 cut(s)	46
AcuI	CTGAAG	1 cut(s)	33
AjuI	GAANNNNNNNTTGG	2 cut(s)	33, 65
BfuAI	ACCTGC	1 cut(s)	19
BisI	GCNGC	1 cut(s)	47
BlsI	GCNGC	1 cut(s)	48
BpuEI	CTTGAG	1 cut(s)	83
Bse3DI	GCAATG	1 cut(s)	17
BseMI	GCAATG	1 cut(s)	17
BspACI	CCGC	1 cut(s)	46
BspHI	TCATGA	2 cut(s)	52, 128
BspMI	ACCTGC	1 cut(s)	19
BsrDI	GCAATG	1 cut(s)	17
BveI	ACCTGC	1 cut(s)	19
CciI	TCATGA	2 cut(s)	52, 128
CviAII	CATG	2 cut(s)	53, 129
CviJI	RGCY	1 cut(s)	49
CviKI_1	RGCY	1 cut(s)	49
Eco57I	CTGAAG	1 cut(s)	33
FaeI	CATG	2 cut(s)	56, 132
FaiI	YATR	2 cut(s)	54, 130
FatI	CATG	2 cut(s)	52, 128
Fnu4HI	GCNGC	1 cut(s)	47
Fsp4HI	GCNGC	1 cut(s)	47
FspEI	CC	7 cut(s)	14, 31, 53, 68, 77, 86, 86
GluI	GCNGC	1 cut(s)	47
Hin1II	CATG	2 cut(s)	56, 132
Hpy188III	TCNNGA	3 cut(s)	53, 83, 129
HpyCH4V	TGCA	2 cut(s)	28, 99
Hsp92II	CATG	2 cut(s)	56, 132
LpnPI	CCDG	2 cut(s)	14, 68
MaeIII	GTNAC	2 cut(s)	68, 116
NlaIII	CATG	2 cut(s)	56, 132
NmuCI	GTSAC	1 cut(s)	68
PagI	TCATGA	2 cut(s)	52, 128
PkrI	GCNGC	1 cut(s)	48
SatI	GCNGC	1 cut(s)	47
SetI	ASST	2 cut(s)	33, 105
SgeI	CNNG	6 cut(s)	41, 65, 74, 80, 95, 112
SmlI	CTYRAG	1 cut(s)	62
SmoI	CTYRAG	1 cut(s)	62
SsiI	CCGC	1 cut(s)	46
TaqII	GACCGA	1 cut(s)	87
TauI	GCSGC	1 cut(s)	49
TseFI	GTSAC	1 cut(s)	68
Tsp45I	GTSAC	1 cut(s)	68
TspDTI	ATGAA	3 cut(s)	41, 69, 112

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.