Rroxscaffold_7G00210970

Functions as component of the Arp2 3 complex which is involved in regulation of actin polymerization and together with an activating nucleation-promoting factor (NPF) mediates the formation of branched actin networks

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Reverse (-)
61374241 .. 61378756
4516 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00210970.1

Sequence Viewer

Length: 171 bp
ATGGGTATTACCGAAGCATTGCGATTGCGGGTAGAACTCCAAAAGTGGCTTCATGAACAACTTGAGCGTCACCAATTTTTTTCTGGGATAGATTGGAGTGCAAAGTCAAACAAAATAGTTACTTCATATCATGATTGGAACTTGAGAAGACTTCCTTGTACCTCCGCTTAA

Protein Analysis

56

Amino Acids

6.7

Weight (kDa)

9.1

Isoelectric Point (pI)

56.33

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Myb_CC_LHEQLE PF14379 1 - 22 2.2e-06 MYB-CC type transfactor, LHEQLE motif
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 28, 165
AfaI GTAC 1 cut(s) 160
AjuI GAANNNNNNNTTGG 2 cut(s) 33, 65
AsuHPI GGTGA 1 cut(s) 62
BbsI GAAGAC 1 cut(s) 154
BpiI GAAGAC 1 cut(s) 154
BpuEI CTTGAG 2 cut(s) 83, 163
Bse3DI GCAATG 1 cut(s) 17
BseMI GCAATG 1 cut(s) 17
BspACI CCGC 2 cut(s) 28, 165
BspHI TCATGA 2 cut(s) 52, 130
BsrDI GCAATG 1 cut(s) 17
BstV2I GAAGAC 1 cut(s) 154
CciI TCATGA 2 cut(s) 52, 130
CseI GACGC 1 cut(s) 56
Csp6I GTAC 1 cut(s) 159
CviAII CATG 2 cut(s) 53, 131
CviJI RGCY 1 cut(s) 49
CviKI_1 RGCY 1 cut(s) 49
CviQI GTAC 1 cut(s) 159
FaeI CATG 2 cut(s) 56, 134
FaiI YATR 3 cut(s) 54, 127, 132
FalI AAGNNNNNCTT 2 cut(s) 139, 171
FatI CATG 2 cut(s) 52, 130
FauI CCCGC 1 cut(s) 21
HgaI GACGC 1 cut(s) 56
Hin1II CATG 2 cut(s) 56, 134
HphI GGTGA 1 cut(s) 62
Hpy188III TCNNGA 2 cut(s) 53, 131
HpyCH4V TGCA 1 cut(s) 101
Hsp92II CATG 2 cut(s) 56, 134
LpnPI CCDG 1 cut(s) 69
MaeIII GTNAC 2 cut(s) 68, 118
MboII GAAGA 1 cut(s) 159
MluCI AATT 1 cut(s) 74
MseI TTAA 1 cut(s) 169
NlaIII CATG 2 cut(s) 56, 134
NmuCI GTSAC 1 cut(s) 68
PagI TCATGA 2 cut(s) 52, 130
RsaI GTAC 1 cut(s) 160
RsaNI GTAC 1 cut(s) 159
SaqAI TTAA 1 cut(s) 169
SetI ASST 1 cut(s) 164
SgeI CNNG 6 cut(s) 41, 65, 74, 96, 143, 154
SmlI CTYRAG 2 cut(s) 62, 142
SmoI CTYRAG 2 cut(s) 62, 142
Sse9I AATT 1 cut(s) 74
SsiI CCGC 2 cut(s) 28, 165
TasI AATT 1 cut(s) 74
Tru1I TTAA 1 cut(s) 169
Tru9I TTAA 1 cut(s) 169
TseFI GTSAC 1 cut(s) 68
Tsp45I GTSAC 1 cut(s) 68
TspDTI ATGAA 3 cut(s) 41, 69, 114
XcmI CCANNNNNNNNNTGG 1 cut(s) 80
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.