RchiOBHm_Chr5g0035391

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
29272007 .. 29275907
3901 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ31428

Sequence Viewer

Length: 132 bp
ATGGGTATTACTGAAGCATTGCGATTGCAGGTAGAACTCCAAAAGCGGCTTCATGAACAACTTGAGCGTGACCGATTTTTTCTGGATAGATTGGAGTGCAAGGTCAAACAAAATAGTTACTTCATCTCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

43

Amino Acids

5.28

Weight (kDa)

7.94

Isoelectric Point (pI)

51.79

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Myb_CC_LHEQLE PF14379 1 - 25 9.8e-10 MYB-CC type transfactor, LHEQLE motif
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 19
AciI CCGC 1 cut(s) 46
AcuI CTGAAG 1 cut(s) 33
AjuI GAANNNNNNNTTGG 2 cut(s) 33, 65
BfuAI ACCTGC 1 cut(s) 19
BisI GCNGC 1 cut(s) 47
BlsI GCNGC 1 cut(s) 48
BpuEI CTTGAG 1 cut(s) 83
Bse3DI GCAATG 1 cut(s) 17
BseMI GCAATG 1 cut(s) 17
BspACI CCGC 1 cut(s) 46
BspHI TCATGA 2 cut(s) 52, 128
BspMI ACCTGC 1 cut(s) 19
BsrDI GCAATG 1 cut(s) 17
BveI ACCTGC 1 cut(s) 19
CciI TCATGA 2 cut(s) 52, 128
CviAII CATG 2 cut(s) 53, 129
CviJI RGCY 1 cut(s) 49
CviKI_1 RGCY 1 cut(s) 49
Eco57I CTGAAG 1 cut(s) 33
FaeI CATG 2 cut(s) 56, 132
FaiI YATR 2 cut(s) 54, 130
FatI CATG 2 cut(s) 52, 128
Fnu4HI GCNGC 1 cut(s) 47
Fsp4HI GCNGC 1 cut(s) 47
FspEI CC 7 cut(s) 14, 31, 53, 68, 77, 86, 86
GluI GCNGC 1 cut(s) 47
Hin1II CATG 2 cut(s) 56, 132
Hpy188III TCNNGA 3 cut(s) 53, 83, 129
HpyCH4V TGCA 2 cut(s) 28, 99
Hsp92II CATG 2 cut(s) 56, 132
LpnPI CCDG 2 cut(s) 14, 68
MaeIII GTNAC 2 cut(s) 68, 116
NlaIII CATG 2 cut(s) 56, 132
NmuCI GTSAC 1 cut(s) 68
PagI TCATGA 2 cut(s) 52, 128
PkrI GCNGC 1 cut(s) 48
SatI GCNGC 1 cut(s) 47
SetI ASST 2 cut(s) 33, 105
SgeI CNNG 6 cut(s) 41, 65, 74, 80, 95, 112
SmlI CTYRAG 1 cut(s) 62
SmoI CTYRAG 1 cut(s) 62
SsiI CCGC 1 cut(s) 46
TaqII GACCGA 1 cut(s) 87
TauI GCSGC 1 cut(s) 49
TseFI GTSAC 1 cut(s) 68
Tsp45I GTSAC 1 cut(s) 68
TspDTI ATGAA 3 cut(s) 41, 69, 112
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.