Rh3AG019500

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
OG0013751
Physical Location & Seq
Forward (+)
1242048 .. 1242820
773 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG019500.1

Sequence Viewer

Length: 162 bp
ATGTATTTTTTCTCACCTAAAAAATTGAAGATCATGAGCAGTATGGGGATTGCTGAAGCATTGCGGTTACAGGTAGAACTCCAGAAGCAGCTTCATGAACAACTTGAGAGTCAAAGAAAGTTGCACTTGGAAATTGAGGAACAATCAAAGTACTTGAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

6.38

Weight (kDa)

9.1

Isoelectric Point (pI)

84.76

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Myb_CC_LHEQLE PF14379 16 - 53 5e-15 MYB-CC type transfactor, LHEQLE motif
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 64
AcuI CTGAAG 1 cut(s) 75
AfaI GTAC 1 cut(s) 152
AgsI TTSAA 2 cut(s) 28, 157
AluBI AGCT 1 cut(s) 91
AluI AGCT 1 cut(s) 91
ApeKI GCWGC 1 cut(s) 88
AsuHPI GGTGA 1 cut(s) 6
BbvI GCAGC 1 cut(s) 100
BisI GCNGC 1 cut(s) 89
BlsI GCNGC 1 cut(s) 90
BmcAI AGTACT 1 cut(s) 152
BpmI CTGGAG 1 cut(s) 65
BpuEI CTTGAG 1 cut(s) 125
Bse3DI GCAATG 1 cut(s) 59
BseMI GCAATG 1 cut(s) 59
BseXI GCAGC 1 cut(s) 100
Bsp143I GATC 1 cut(s) 30
BspACI CCGC 1 cut(s) 64
BspHI TCATGA 2 cut(s) 33, 94
BsrDI GCAATG 1 cut(s) 59
BssMI GATC 1 cut(s) 30
BstKTI GATC 1 cut(s) 33
BstMBI GATC 1 cut(s) 30
BstV1I GCAGC 1 cut(s) 100
CciI TCATGA 2 cut(s) 33, 94
Csp6I GTAC 1 cut(s) 151
CviAII CATG 2 cut(s) 34, 95
CviJI RGCY 1 cut(s) 91
CviKI_1 RGCY 1 cut(s) 91
CviQI GTAC 1 cut(s) 151
DpnI GATC 1 cut(s) 32
DpnII GATC 1 cut(s) 30
Eco57I CTGAAG 1 cut(s) 75
FaeI CATG 2 cut(s) 37, 98
FaiI YATR 3 cut(s) 35, 44, 96
FalI AAGNNNNNCTT 2 cut(s) 110, 142
FatI CATG 2 cut(s) 33, 94
Fnu4HI GCNGC 1 cut(s) 89
Fsp4HI GCNGC 1 cut(s) 89
FspEI CC 9 cut(s) 29, 30, 30, 31, 49, 56, 95, 113, 122
GluI GCNGC 1 cut(s) 89
GsuI CTGGAG 1 cut(s) 65
Hin1II CATG 2 cut(s) 37, 98
HinfI GANTC 1 cut(s) 109
HphI GGTGA 1 cut(s) 6
Hpy188III TCNNGA 3 cut(s) 34, 82, 95
HpyCH4V TGCA 1 cut(s) 124
Hsp92II CATG 2 cut(s) 37, 98
Kzo9I GATC 1 cut(s) 30
LpnPI CCDG 2 cut(s) 56, 95
Lsp1109I GCAGC 1 cut(s) 100
MaeIII GTNAC 1 cut(s) 66
MalI GATC 1 cut(s) 32
MboI GATC 1 cut(s) 30
MboII GAAGA 1 cut(s) 40
MluCI AATT 2 cut(s) 23, 132
MlyI GAGTC 1 cut(s) 118
MnlI CCTC 1 cut(s) 130
NdeII GATC 1 cut(s) 30
NlaIII CATG 2 cut(s) 37, 98
PagI TCATGA 2 cut(s) 33, 94
PkrI GCNGC 1 cut(s) 90
PleI GAGTC 1 cut(s) 117
PpsI GAGTC 1 cut(s) 117
RsaI GTAC 1 cut(s) 152
RsaNI GTAC 1 cut(s) 151
SatI GCNGC 1 cut(s) 89
Sau3AI GATC 1 cut(s) 30
ScaI AGTACT 1 cut(s) 152
SchI GAGTC 1 cut(s) 118
SetI ASST 3 cut(s) 19, 75, 93
SgeI CNNG 6 cut(s) 46, 83, 94, 107, 116, 139
SmlI CTYRAG 1 cut(s) 104
SmoI CTYRAG 1 cut(s) 104
Sse9I AATT 2 cut(s) 23, 132
SsiI CCGC 1 cut(s) 64
TasI AATT 2 cut(s) 23, 132
TatI WGTACW 1 cut(s) 150
TseI GCWGC 1 cut(s) 88
TspDTI ATGAA 2 cut(s) 83, 111
ZrmI AGTACT 1 cut(s) 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.