RchiOBHm_Chr1g0376361

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
63572258 .. 63573095
838 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ60001

Sequence Viewer

Length: 141 bp
ATGACATACGTCATTATGGTTGCCTCCTTTCATTGGAGGTGCAGTTTGTCCACGTTGTGGATATTCCCTAGGAGGGTTACTGCTACTACCACGTCTTATGATGCGACCTCCACGGCCCTTATTCGTATATTATTCCACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

46

Amino Acids

5.37

Weight (kDa)

10.04

Isoelectric Point (pI)

36.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 57
AdeI CACNNNGTG 1 cut(s) 57
AfiI CCNNNNNNNGG 3 cut(s) 33, 57, 73
AjiI CACGTC 1 cut(s) 93
AoxI GGCC 1 cut(s) 114
AspA2I CCTAGG 1 cut(s) 68
AspS9I GGNCC 1 cut(s) 115
AvrII CCTAGG 1 cut(s) 68
BceAI ACGGC 1 cut(s) 129
BfaI CTAG 1 cut(s) 69
BlnI CCTAGG 1 cut(s) 68
BmgBI CACGTC 1 cut(s) 93
BmgT120I GGNCC 1 cut(s) 115
BmsI GCATC 1 cut(s) 91
BoxI GACNNNNGTC 1 cut(s) 8
BsaJI CCNNGG 2 cut(s) 68, 111
BsaXI ACNNNNNCTCC 2 cut(s) 28, 58
Bsc4I CCNNNNNNNGG 3 cut(s) 33, 57, 73
BseDI CCNNGG 2 cut(s) 68, 111
BseLI CCNNNNNNNGG 3 cut(s) 33, 57, 73
BsgI GTGCAG 1 cut(s) 61
BshFI GGCC 1 cut(s) 116
BslI CCNNNNNNNGG 3 cut(s) 33, 57, 73
BsnI GGCC 1 cut(s) 116
BspANI GGCC 1 cut(s) 116
BssECI CCNNGG 2 cut(s) 68, 111
BssT1I CCWWGG 1 cut(s) 68
BstDSI CCRYGG 1 cut(s) 111
BstPAI GACNNNNGTC 1 cut(s) 8
BsuRI GGCC 1 cut(s) 116
BtgI CCRYGG 1 cut(s) 111
BtrI CACGTC 1 cut(s) 93
BtsIMutI CAGTG 1 cut(s) 136
Cfr13I GGNCC 1 cut(s) 115
CviJI RGCY 1 cut(s) 116
CviKI_1 RGCY 1 cut(s) 116
DraIII CACNNNGTG 1 cut(s) 57
Eco130I CCWWGG 1 cut(s) 68
EcoT14I CCWWGG 1 cut(s) 68
ErhI CCWWGG 1 cut(s) 68
FaiI YATR 4 cut(s) 7, 17, 99, 128
FspBI CTAG 1 cut(s) 69
HaeIII GGCC 1 cut(s) 116
Hpy166II GTNNAC 1 cut(s) 51
Hpy8I GTNNAC 1 cut(s) 51
HpyCH4IV ACGT 3 cut(s) 9, 53, 92
HpyCH4V TGCA 1 cut(s) 42
HpySE526I ACGT 3 cut(s) 9, 53, 92
LweI GCATC 1 cut(s) 91
MaeI CTAG 1 cut(s) 69
MaeII ACGT 3 cut(s) 9, 53, 92
MaeIII GTNAC 1 cut(s) 76
MnlI CCTC 4 cut(s) 30, 34, 66, 118
PflMI CCANNNNNTGG 1 cut(s) 57
PshAI GACNNNNGTC 1 cut(s) 8
PspPI GGNCC 1 cut(s) 115
Sau96I GGNCC 1 cut(s) 115
SetI ASST 5 cut(s) 12, 41, 56, 95, 110
SfaNI GCATC 1 cut(s) 91
SgeI CNNG 4 cut(s) 64, 81, 103, 124
SspMI CTAG 1 cut(s) 69
StyI CCWWGG 1 cut(s) 68
TaiI ACGT 3 cut(s) 12, 56, 95
TspDTI ATGAA 1 cut(s) 20
Van91I CCANNNNNTGG 1 cut(s) 57
XmaJI CCTAGG 1 cut(s) 68
XspI CTAG 1 cut(s) 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.