RchiOBHm_Chr6g0263491

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
18354707 .. 18361399
6693 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ23633

Sequence Viewer

Length: 228 bp
ATGAAATCTTGTGATGCGTCTAGCATTGACATCAATTCGATAGTTTTTGGCTATCATCAATGCAGAGACGGGGAAGGTGGAGAGAGTCTTCTCGATCAACATCGTATCATTTTTGGCTATCATCAATGCAGAGACGGGGAAGGTGGAGAGAGTCTTCTCGATCAACATCGTATCAGTGATGTTCTGCCCACAGAATTCCATCATAGACTTGATACGAAGTGCTTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

8.52

Weight (kDa)

5.3

Isoelectric Point (pI)

24.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 194
Alw26I GTCTC 2 cut(s) 60, 126
ApoI RAATTY 1 cut(s) 194
Asp700I GAANNNNTTC 1 cut(s) 221
BbsI GAAGAC 2 cut(s) 80, 146
BccI CCATC 1 cut(s) 207
BcoDI GTCTC 2 cut(s) 60, 126
BfaI CTAG 1 cut(s) 21
BmsI GCATC 1 cut(s) 4
BpiI GAAGAC 2 cut(s) 80, 146
BsaBI GATNNNNATC 2 cut(s) 99, 165
Bse8I GATNNNNATC 2 cut(s) 99, 165
BseJI GATNNNNATC 2 cut(s) 99, 165
BsmAI GTCTC 2 cut(s) 60, 126
BsmBI CGTCTC 2 cut(s) 60, 126
Bsp143I GATC 2 cut(s) 94, 160
BssMI GATC 2 cut(s) 94, 160
BstKTI GATC 2 cut(s) 97, 163
BstMAI GTCTC 2 cut(s) 60, 126
BstMBI GATC 2 cut(s) 94, 160
BstV2I GAAGAC 2 cut(s) 80, 146
BtsIMutI CAGTG 1 cut(s) 181
CseI GACGC 1 cut(s) 6
CviJI RGCY 2 cut(s) 51, 117
CviKI_1 RGCY 2 cut(s) 51, 117
DpnI GATC 2 cut(s) 96, 162
DpnII GATC 2 cut(s) 94, 160
EcoRI GAATTC 1 cut(s) 194
Esp3I CGTCTC 2 cut(s) 60, 126
FaiI YATR 1 cut(s) 204
FspBI CTAG 1 cut(s) 21
HgaI GACGC 1 cut(s) 6
HinfI GANTC 2 cut(s) 85, 151
Hpy188I TCNGA 1 cut(s) 227
Hpy188III TCNNGA 2 cut(s) 92, 158
HpyAV CCTTC 2 cut(s) 68, 134
HpyCH4V TGCA 2 cut(s) 63, 129
Kzo9I GATC 2 cut(s) 94, 160
LweI GCATC 1 cut(s) 4
MaeI CTAG 1 cut(s) 21
MalI GATC 2 cut(s) 96, 162
MboI GATC 2 cut(s) 94, 160
MboII GAAGA 2 cut(s) 80, 146
MluCI AATT 2 cut(s) 34, 194
MlyI GAGTC 2 cut(s) 94, 160
MroXI GAANNNNTTC 1 cut(s) 221
NdeII GATC 2 cut(s) 94, 160
PdmI GAANNNNTTC 1 cut(s) 221
PleI GAGTC 2 cut(s) 93, 159
PpsI GAGTC 2 cut(s) 93, 159
Sau3AI GATC 2 cut(s) 94, 160
SchI GAGTC 2 cut(s) 94, 160
SetI ASST 2 cut(s) 79, 145
SfaNI GCATC 1 cut(s) 4
SgeI CNNG 7 cut(s) 21, 33, 82, 104, 148, 170, 221
Sse9I AATT 2 cut(s) 34, 194
SspMI CTAG 1 cut(s) 21
TaqI TCGA 3 cut(s) 38, 93, 159
TasI AATT 2 cut(s) 34, 194
TscAI CASTG 1 cut(s) 181
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 181
XapI RAATTY 1 cut(s) 194
XmnI GAANNNNTTC 1 cut(s) 221
XspI CTAG 1 cut(s) 21
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.