RchiOBHm_Chr2g0170051

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
84072299 .. 84072979
681 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ53761

Sequence Viewer

Length: 222 bp
ATGAAATCTTGTGATGCGTCTAGCATTGACATCAATCCGATAGTTTTTGGCTATCATCAACGCAGAGATGGGGAAGGTGGAGAGAGTTTTCTCGATCAACATCGTATCAGTGATGTCTTGTCCACAAAATTCCATCATAGACTTGATACGGAGTGCTTCCGAATTGTAGTCAAGTACAGACTTGAAATCACAGAAGCGAAGGCTATGCCATTTCACTTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

73

Amino Acids

8.53

Weight (kDa)

6.49

Isoelectric Point (pI)

43.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 128
AfaI GTAC 1 cut(s) 176
AgsI TTSAA 1 cut(s) 185
ApoI RAATTY 1 cut(s) 128
BccI CCATC 2 cut(s) 62, 141
BcgI CGANNNNNNTGC 2 cut(s) 187, 221
BfaI CTAG 1 cut(s) 21
BmsI GCATC 1 cut(s) 4
BsaBI GATNNNNATC 1 cut(s) 99
Bse8I GATNNNNATC 1 cut(s) 99
BseJI GATNNNNATC 1 cut(s) 99
Bsp143I GATC 1 cut(s) 94
BssMI GATC 1 cut(s) 94
BstKTI GATC 1 cut(s) 97
BstMBI GATC 1 cut(s) 94
BtsIMutI CAGTG 1 cut(s) 115
CseI GACGC 1 cut(s) 6
Csp6I GTAC 1 cut(s) 175
CviJI RGCY 2 cut(s) 51, 203
CviKI_1 RGCY 2 cut(s) 51, 203
CviQI GTAC 1 cut(s) 175
DpnI GATC 1 cut(s) 96
DpnII GATC 1 cut(s) 94
FaiI YATR 2 cut(s) 138, 206
FspBI CTAG 1 cut(s) 21
HgaI GACGC 1 cut(s) 6
Hpy166II GTNNAC 1 cut(s) 123
Hpy188I TCNGA 2 cut(s) 39, 161
Hpy188III TCNNGA 1 cut(s) 92
Hpy8I GTNNAC 1 cut(s) 123
HpyAV CCTTC 2 cut(s) 68, 193
Kzo9I GATC 1 cut(s) 94
LweI GCATC 1 cut(s) 4
MaeI CTAG 1 cut(s) 21
MalI GATC 1 cut(s) 96
MboI GATC 1 cut(s) 94
MluCI AATT 2 cut(s) 128, 162
NdeII GATC 1 cut(s) 94
RsaI GTAC 1 cut(s) 176
RsaNI GTAC 1 cut(s) 175
Sau3AI GATC 1 cut(s) 94
SetI ASST 1 cut(s) 79
SfaNI GCATC 1 cut(s) 4
SgeI CNNG 7 cut(s) 21, 33, 104, 130, 155, 184, 194
Sse9I AATT 2 cut(s) 128, 162
SspMI CTAG 1 cut(s) 21
TaqI TCGA 1 cut(s) 93
TasI AATT 2 cut(s) 128, 162
TatI WGTACW 1 cut(s) 174
TscAI CASTG 1 cut(s) 115
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 164
TspRI CASTG 1 cut(s) 115
XapI RAATTY 1 cut(s) 128
XspI CTAG 1 cut(s) 21
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.