RchiOBHm_Chr1g0381171

Serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
66534063 .. 66534293
231 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ60437

Sequence Viewer

Length: 195 bp
ATGGTATGCAATCTGGCAGAAAGAGTGATCCCAGGAATTGAGTTGGTGCGATTAGCATCATGGTGTTTGCAGTATGAACCTCGTGAGAGGCCAAATGCCAAGTCTCTTGTGACTGCCCTTGTTCTTCTTCAAAAGGAAACTTCGTTGAAGCGTAAAGATATTATATCAGCTTTTGTTTCATGTATAGGTAGTTAG

Protein Analysis

64

Amino Acids

7.16

Weight (kDa)

9.02

Isoelectric Point (pI)

38.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 22
AgsI TTSAA 2 cut(s) 131, 148
AjnI CCWGG 1 cut(s) 31
AluBI AGCT 1 cut(s) 170
AluI AGCT 1 cut(s) 170
Alw26I GTCTC 1 cut(s) 108
AlwI GGATC 1 cut(s) 22
AoxI GGCC 1 cut(s) 89
ArsI GACNNNNNNTTYG 2 cut(s) 86, 118
BauI CACGAG 1 cut(s) 81
BciT130I CCWGG 1 cut(s) 33
BcoDI GTCTC 1 cut(s) 108
Bme1390I CCNGG 1 cut(s) 33
BmrFI CCNGG 1 cut(s) 33
BmsI GCATC 1 cut(s) 65
BsaBI GATNNNNATC 1 cut(s) 55
BsaJI CCNNGG 1 cut(s) 31
Bse8I GATNNNNATC 1 cut(s) 55
BseBI CCWGG 1 cut(s) 33
BseDI CCNNGG 1 cut(s) 31
BseJI GATNNNNATC 1 cut(s) 55
BshFI GGCC 1 cut(s) 91
BsmAI GTCTC 1 cut(s) 108
BsnI GGCC 1 cut(s) 91
Bsp143I GATC 1 cut(s) 27
BspANI GGCC 1 cut(s) 91
BspPI GGATC 1 cut(s) 22
BssECI CCNNGG 1 cut(s) 31
BssMI GATC 1 cut(s) 27
BssSI CACGAG 1 cut(s) 81
Bst2BI CACGAG 1 cut(s) 81
Bst2UI CCWGG 1 cut(s) 33
BstKTI GATC 1 cut(s) 30
BstMAI GTCTC 1 cut(s) 108
BstMBI GATC 1 cut(s) 27
BstNI CCWGG 1 cut(s) 33
BstSCI CCNGG 1 cut(s) 31
BsuRI GGCC 1 cut(s) 91
CviAII CATG 2 cut(s) 60, 180
CviJI RGCY 2 cut(s) 91, 170
CviKI_1 RGCY 2 cut(s) 91, 170
DpnI GATC 1 cut(s) 29
DpnII GATC 1 cut(s) 27
EcoRII CCWGG 1 cut(s) 31
FaeI CATG 2 cut(s) 63, 183
FaiI YATR 6 cut(s) 7, 61, 75, 164, 181, 185
FatI CATG 2 cut(s) 59, 179
HaeIII GGCC 1 cut(s) 91
Hin1II CATG 2 cut(s) 63, 183
Hpy188III TCNNGA 1 cut(s) 83
HpyCH4V TGCA 2 cut(s) 9, 70
Hsp92II CATG 2 cut(s) 63, 183
Kzo9I GATC 1 cut(s) 27
LpnPI CCDG 2 cut(s) 18, 45
LweI GCATC 1 cut(s) 65
MaeIII GTNAC 1 cut(s) 109
MalI GATC 1 cut(s) 29
MboI GATC 1 cut(s) 27
MboII GAAGA 2 cut(s) 116, 119
MluCI AATT 1 cut(s) 36
MnlI CCTC 2 cut(s) 81, 90
MslI CAYNNNNRTG 1 cut(s) 61
MspR9I CCNGG 1 cut(s) 33
MvaI CCWGG 1 cut(s) 33
NdeII GATC 1 cut(s) 27
NlaIII CATG 2 cut(s) 63, 183
NmuCI GTSAC 1 cut(s) 109
Psp6I CCWGG 1 cut(s) 31
PspGI CCWGG 1 cut(s) 31
RseI CAYNNNNRTG 1 cut(s) 61
Sau3AI GATC 1 cut(s) 27
ScrFI CCNGG 1 cut(s) 33
SetI ASST 3 cut(s) 82, 172, 190
SfaNI GCATC 1 cut(s) 65
SgeI CNNG 9 cut(s) 26, 44, 45, 72, 93, 95, 112, 119, 131
SmiMI CAYNNNNRTG 1 cut(s) 61
Sse9I AATT 1 cut(s) 36
StyD4I CCNGG 1 cut(s) 31
TasI AATT 1 cut(s) 36
TseFI GTSAC 1 cut(s) 109
Tsp45I GTSAC 1 cut(s) 109
TspDTI ATGAA 2 cut(s) 90, 168
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.