RchiOBHm_Chr2g0170541
ERF Family

heavy metal transport detoxification superfamily protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
84467867 .. 84469390
1524 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ53804

Sequence Viewer

Length: 180 bp
ATGGCAACTGAAGGGATTACCAACTTGAAGGTTGAAGTTCATAAGGGTATTGGAGTTGTTGAGACAACAGTACAAGCTACTGGGGTGGCTTCCAGTTTGGTTGAGGCTATACAGAGTTCAGGGTTTAAGCTACAAACGTTGAATTTGAGTTTCGAGGAAGAAGAGGAAATTGTTGTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

59

Amino Acids

6.26

Weight (kDa)

4.37

Isoelectric Point (pI)

47.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013272)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 137
AcsI RAATTY 1 cut(s) 142
AcuI CTGAAG 1 cut(s) 30
AfaI GTAC 1 cut(s) 72
AgsI TTSAA 3 cut(s) 28, 35, 142
AluBI AGCT 2 cut(s) 77, 130
AluI AGCT 2 cut(s) 77, 130
Alw26I GTCTC 1 cut(s) 56
ApoI RAATTY 1 cut(s) 142
BcoDI GTCTC 1 cut(s) 56
BmrI ACTGGG 1 cut(s) 90
BmuI ACTGGG 1 cut(s) 90
Bse1I ACTGG 2 cut(s) 85, 93
BseNI ACTGG 2 cut(s) 85, 93
BsmAI GTCTC 1 cut(s) 56
BsrI ACTGG 2 cut(s) 85, 93
Bst4CI ACNGT 1 cut(s) 70
Bst6I CTCTTC 1 cut(s) 156
BstMAI GTCTC 1 cut(s) 56
Csp6I GTAC 1 cut(s) 71
CviJI RGCY 4 cut(s) 77, 89, 107, 130
CviKI_1 RGCY 4 cut(s) 77, 89, 107, 130
CviQI GTAC 1 cut(s) 71
Eam1104I CTCTTC 1 cut(s) 156
EarI CTCTTC 1 cut(s) 156
Eco57I CTGAAG 1 cut(s) 30
FaiI YATR 3 cut(s) 42, 110, 178
HpyAV CCTTC 2 cut(s) 5, 22
HpyCH4III ACNGT 1 cut(s) 70
HpyCH4IV ACGT 1 cut(s) 137
HpySE526I ACGT 1 cut(s) 137
LpnPI CCDG 3 cut(s) 66, 105, 106
MaeII ACGT 1 cut(s) 137
MboII GAAGA 2 cut(s) 170, 173
MluCI AATT 2 cut(s) 142, 168
MnlI CCTC 3 cut(s) 97, 148, 157
MseI TTAA 1 cut(s) 126
Psp1406I AACGTT 1 cut(s) 137
RsaI GTAC 1 cut(s) 72
RsaNI GTAC 1 cut(s) 71
SaqAI TTAA 1 cut(s) 126
SetI ASST 4 cut(s) 33, 79, 132, 140
SgeI CNNG 6 cut(s) 37, 86, 93, 105, 132, 166
Sse9I AATT 2 cut(s) 142, 168
TaaI ACNGT 1 cut(s) 70
TaiI ACGT 1 cut(s) 140
TaqI TCGA 1 cut(s) 153
TasI AATT 2 cut(s) 142, 168
TatI WGTACW 1 cut(s) 70
Tru1I TTAA 1 cut(s) 126
Tru9I TTAA 1 cut(s) 126
TspDTI ATGAA 1 cut(s) 29
XapI RAATTY 1 cut(s) 142
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.