RchiOBHm_Chr2g0174001

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
86771330 .. 86771479
150 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ54117

Sequence Viewer

Length: 150 bp
ATGAAGGTCAGGGTGGTGTATAGGAAAGTGCGGGATTACATTCGTTATGATCTGAAAGAGATCACATTTCCATCATCACTGCCGGACCCTCCTTATATCACCTGGCATGACCGCTTCTTGCTACGCCATTCTTTCATTATCATTATATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

49

Amino Acids

6.11

Weight (kDa)

9.86

Isoelectric Point (pI)

35.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 31, 112
AjnI CCWGG 1 cut(s) 101
AspS9I GGNCC 1 cut(s) 85
AsuHPI GGTGA 1 cut(s) 91
AvaII GGWCC 1 cut(s) 85
BccI CCATC 1 cut(s) 79
BciT130I CCWGG 1 cut(s) 103
Bme1390I CCNGG 1 cut(s) 103
Bme18I GGWCC 1 cut(s) 85
BmgT120I GGNCC 1 cut(s) 85
BmiI GGNNCC 1 cut(s) 87
BmrFI CCNGG 1 cut(s) 103
BseBI CCWGG 1 cut(s) 103
BsiSI CCGG 1 cut(s) 83
Bsp143I GATC 2 cut(s) 49, 60
BspACI CCGC 2 cut(s) 31, 112
BspLI GGNNCC 1 cut(s) 87
BssMI GATC 2 cut(s) 49, 60
Bst2UI CCWGG 1 cut(s) 103
BstKTI GATC 2 cut(s) 52, 63
BstMBI GATC 2 cut(s) 49, 60
BstNI CCWGG 1 cut(s) 103
BstSCI CCNGG 1 cut(s) 101
BtsI GCAGTG 1 cut(s) 77
BtsIMutI CAGTG 1 cut(s) 77
Cfr13I GGNCC 1 cut(s) 85
CviAII CATG 1 cut(s) 107
DpnI GATC 2 cut(s) 51, 62
DpnII GATC 2 cut(s) 49, 60
Eco47I GGWCC 1 cut(s) 85
EcoRII CCWGG 1 cut(s) 101
FaeI CATG 1 cut(s) 110
FaiI YATR 6 cut(s) 21, 48, 96, 108, 146, 148
FatI CATG 1 cut(s) 106
FauI CCCGC 1 cut(s) 24
HapII CCGG 1 cut(s) 83
Hin1II CATG 1 cut(s) 110
HpaII CCGG 1 cut(s) 83
HphI GGTGA 1 cut(s) 91
Hpy188I TCNGA 1 cut(s) 54
Hsp92II CATG 1 cut(s) 110
Kzo9I GATC 2 cut(s) 49, 60
LpnPI CCDG 3 cut(s) 88, 96, 115
MalI GATC 2 cut(s) 51, 62
MboI GATC 2 cut(s) 49, 60
MnlI CCTC 1 cut(s) 99
MspI CCGG 1 cut(s) 83
MspR9I CCNGG 1 cut(s) 103
MvaI CCWGG 1 cut(s) 103
NdeII GATC 2 cut(s) 49, 60
NlaIII CATG 1 cut(s) 110
NlaIV GGNNCC 1 cut(s) 87
Psp6I CCWGG 1 cut(s) 101
PspGI CCWGG 1 cut(s) 101
PspN4I GGNNCC 1 cut(s) 87
PspPI GGNCC 1 cut(s) 85
Sau3AI GATC 2 cut(s) 49, 60
Sau96I GGNCC 1 cut(s) 85
ScrFI CCNGG 1 cut(s) 103
SetI ASST 2 cut(s) 9, 104
SgeI CNNG 7 cut(s) 22, 44, 95, 114, 115, 119, 130
SinI GGWCC 1 cut(s) 85
SsiI CCGC 2 cut(s) 31, 112
StyD4I CCNGG 1 cut(s) 101
TscAI CASTG 1 cut(s) 84
TspDTI ATGAA 2 cut(s) 17, 124
TspRI CASTG 1 cut(s) 84
VpaK11BI GGWCC 1 cut(s) 85
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.