RchiOBHm_Chr4g0415731

39S ribosomal protein L45

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
40451726 .. 40452088
363 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ38595

Sequence Viewer

Length: 165 bp
ATGTTCCTTATGGTTGCAGTTTTGTTGGCCTTCTCTGCATTCCCAGCTAACTTCTTTGCCTTATCCCTTCTCTCCTCATTACAGATTGGTGTTGATCCAAAAGATCTCGAAAAGGTATTTATACAACTTACACTTGAGTTTCTGTCAGAGCAGGTAAACGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

54

Amino Acids

6.04

Weight (kDa)

4.25

Isoelectric Point (pI)

25.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 142
AclWI GGATC 1 cut(s) 89
AluBI AGCT 1 cut(s) 47
AluI AGCT 1 cut(s) 47
AlwI GGATC 1 cut(s) 89
AoxI GGCC 1 cut(s) 27
BfuAI ACCTGC 1 cut(s) 142
BglII AGATCT 1 cut(s) 103
BpuEI CTTGAG 1 cut(s) 155
BseRI GAGGAG 1 cut(s) 64
BseYI CCCAGC 1 cut(s) 43
BshFI GGCC 1 cut(s) 29
BsmI GAATGC 1 cut(s) 38
BsnI GGCC 1 cut(s) 29
Bsp143I GATC 2 cut(s) 94, 103
BspANI GGCC 1 cut(s) 29
BspMI ACCTGC 1 cut(s) 142
BspPI GGATC 1 cut(s) 89
BssMI GATC 2 cut(s) 94, 103
BstKTI GATC 2 cut(s) 97, 106
BstMBI GATC 2 cut(s) 94, 103
BstMWI GCNNNNNNNGC 2 cut(s) 35, 44
BstX2I RGATCY 1 cut(s) 103
BstYI RGATCY 1 cut(s) 103
BsuRI GGCC 1 cut(s) 29
BveI ACCTGC 1 cut(s) 142
CviJI RGCY 2 cut(s) 29, 47
CviKI_1 RGCY 2 cut(s) 29, 47
DpnI GATC 2 cut(s) 96, 105
DpnII GATC 2 cut(s) 94, 103
FaiI YATR 2 cut(s) 11, 122
GsaI CCCAGC 1 cut(s) 47
HaeIII GGCC 1 cut(s) 29
Hpy166II GTNNAC 1 cut(s) 157
Hpy188I TCNGA 1 cut(s) 148
Hpy188III TCNNGA 1 cut(s) 107
Hpy8I GTNNAC 1 cut(s) 157
HpyAV CCTTC 2 cut(s) 40, 77
HpyCH4V TGCA 2 cut(s) 17, 38
HpyF10VI GCNNNNNNNGC 2 cut(s) 35, 44
Kzo9I GATC 2 cut(s) 94, 103
LpnPI CCDG 2 cut(s) 57, 137
MalI GATC 2 cut(s) 96, 105
MboI GATC 2 cut(s) 94, 103
MflI RGATCY 1 cut(s) 103
MnlI CCTC 1 cut(s) 85
Mva1269I GAATGC 1 cut(s) 38
MwoI GCNNNNNNNGC 2 cut(s) 35, 44
NdeII GATC 2 cut(s) 94, 103
PctI GAATGC 1 cut(s) 38
PspFI CCCAGC 1 cut(s) 43
PsuI RGATCY 1 cut(s) 103
Sau3AI GATC 2 cut(s) 94, 103
SetI ASST 3 cut(s) 49, 117, 156
SgeI CNNG 3 cut(s) 56, 119, 146
SmlI CTYRAG 1 cut(s) 134
SmoI CTYRAG 1 cut(s) 134
TaqI TCGA 1 cut(s) 108
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.