RchiOBHm_Chr4g0421091

Serine incorporator

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
OG0003509
Physical Location & Seq
Forward (+)
46704721 .. 46707422
2702 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ39076

Sequence Viewer

Length: 189 bp
ATGTTTCCGACTTTGGTTGCTTGGAAGAGATTGGATTGGTTTGCAATTTGGTTTCGGCATAATGAAGTTCAACATGAAGATGACATCCCTTACAAGTATGGATTCTTCCATCTATTATTTTCCTTGGAGGCCATGTATTTTGCAATGCTACTCATCAGTTGGAACCTCAATAACTCAGCTAAGAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Dirigent Serinc

Protein Analysis

62

Amino Acids

7.64

Weight (kDa)

6.82

Isoelectric Point (pI)

32.21

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Serinc PF03348 22 - 58 1e-06 Serine incorporator (Serinc)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 71
AluBI AGCT 1 cut(s) 179
AluI AGCT 1 cut(s) 179
AoxI GGCC 1 cut(s) 129
BarI GAAGNNNNNNTAC 2 cut(s) 89, 121
BccI CCATC 1 cut(s) 117
BmiI GGNNCC 1 cut(s) 164
BsaJI CCNNGG 1 cut(s) 123
BsaXI ACNNNNNCTCC 2 cut(s) 119, 149
Bse3DI GCAATG 1 cut(s) 150
BseDI CCNNGG 1 cut(s) 123
BseGI GGATG 1 cut(s) 84
BseMI GCAATG 1 cut(s) 150
BseMII CTCAG 1 cut(s) 189
BshFI GGCC 1 cut(s) 131
BsnI GGCC 1 cut(s) 131
BspANI GGCC 1 cut(s) 131
BspCNI CTCAG 1 cut(s) 188
BspLI GGNNCC 1 cut(s) 164
BsrDI GCAATG 1 cut(s) 150
BssECI CCNNGG 1 cut(s) 123
BssT1I CCWWGG 1 cut(s) 123
Bst6I CTCTTC 1 cut(s) 20
BstDEI CTNAG 2 cut(s) 175, 180
BstF5I GGATG 1 cut(s) 84
BsuRI GGCC 1 cut(s) 131
BtsCI GGATG 1 cut(s) 84
CviAII CATG 2 cut(s) 74, 133
CviJI RGCY 2 cut(s) 131, 179
CviKI_1 RGCY 2 cut(s) 131, 179
DdeI CTNAG 2 cut(s) 175, 180
Eam1104I CTCTTC 1 cut(s) 20
EarI CTCTTC 1 cut(s) 20
Eco130I CCWWGG 1 cut(s) 123
EcoT14I CCWWGG 1 cut(s) 123
ErhI CCWWGG 1 cut(s) 123
FaeI CATG 2 cut(s) 77, 136
FaiI YATR 4 cut(s) 60, 75, 99, 134
FatI CATG 2 cut(s) 73, 132
FokI GGATG 1 cut(s) 71
HaeIII GGCC 1 cut(s) 131
Hin1II CATG 2 cut(s) 77, 136
HinfI GANTC 1 cut(s) 102
Hpy188I TCNGA 1 cut(s) 9
HpyCH4V TGCA 2 cut(s) 44, 143
HpyF3I CTNAG 2 cut(s) 175, 180
Hsp92II CATG 2 cut(s) 77, 136
MboII GAAGA 3 cut(s) 37, 89, 97
MluCI AATT 1 cut(s) 45
MmeI TCCRAC 2 cut(s) 32, 140
MnlI CCTC 2 cut(s) 121, 176
MslI CAYNNNNRTG 1 cut(s) 78
NlaIII CATG 2 cut(s) 77, 136
NlaIV GGNNCC 1 cut(s) 164
PfeI GAWTC 1 cut(s) 102
PspN4I GGNNCC 1 cut(s) 164
RseI CAYNNNNRTG 1 cut(s) 78
SetI ASST 2 cut(s) 168, 181
SgeI CNNG 5 cut(s) 33, 86, 106, 136, 145
SmiMI CAYNNNNRTG 1 cut(s) 78
Sse9I AATT 1 cut(s) 45
StyI CCWWGG 1 cut(s) 123
TasI AATT 1 cut(s) 45
TfiI GAWTC 1 cut(s) 102
TspDTI ATGAA 2 cut(s) 78, 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.