Rh2CG182400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Forward (+)
16844413 .. 16847505
3093 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG182400.1

Sequence Viewer

Length: 270 bp
ATGGAGCATGGTGCAAAGAATGGTTATCCAATCAGGTCCTCGCGATCGCAGACCTCTTCAAATCTAATTGCAGAGGGAATCCAAAGCCACCAAATCCGTATCCAGGTCCTCCAAGGCCGGCCTCCAGTTTCTGGTCGGCTGTCTGCAATGTTTCCGATTTTGGTTGCTTGGAAGAGATTGGACTGGTTTGCAATCTGGGTATGCAGTTTCGGCATAATGAAGTTCAACATGAAGATGATGTCCCTTACAAGTATGGATTCTTCCATCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

89

Amino Acids

10.06

Weight (kDa)

10.52

Isoelectric Point (pI)

56.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 131
AccII CGCG 1 cut(s) 43
AfiI CCNNNNNNNGG 2 cut(s) 103, 131
AgsI TTSAA 2 cut(s) 60, 226
AjnI CCWGG 1 cut(s) 102
AlwNI CAGNNNCTG 1 cut(s) 131
AoxI GGCC 2 cut(s) 115, 119
AsiSI GCGATCGC 1 cut(s) 47
AspS9I GGNCC 2 cut(s) 36, 106
AvaII GGWCC 2 cut(s) 36, 106
BarI GAAGNNNNNNTAC 1 cut(s) 244
BciT130I CCWGG 1 cut(s) 104
BciVI GTATCC 1 cut(s) 110
BfaI CTAG 1 cut(s) 268
BfuI GTATCC 1 cut(s) 110
Bme1390I CCNGG 1 cut(s) 104
Bme18I GGWCC 2 cut(s) 36, 106
BmgT120I GGNCC 2 cut(s) 36, 106
BmrFI CCNGG 1 cut(s) 104
BpmI CTGGAG 1 cut(s) 108
BsaJI CCNNGG 1 cut(s) 112
Bsc4I CCNNNNNNNGG 2 cut(s) 103, 131
Bse118I RCCGGY 1 cut(s) 117
Bse1I ACTGG 2 cut(s) 125, 188
Bse3DI GCAATG 1 cut(s) 153
BseBI CCWGG 1 cut(s) 104
BseDI CCNNGG 1 cut(s) 112
BseLI CCNNNNNNNGG 2 cut(s) 103, 131
BseMI GCAATG 1 cut(s) 153
BseNI ACTGG 2 cut(s) 125, 188
Bsh1236I CGCG 1 cut(s) 43
Bsh1285I CGRYCG 1 cut(s) 47
BshFI GGCC 2 cut(s) 117, 121
BsiEI CGRYCG 1 cut(s) 47
BsiSI CCGG 1 cut(s) 118
BslFI GGGAC 1 cut(s) 226
BslI CCNNNNNNNGG 2 cut(s) 103, 131
BsmFI GGGAC 1 cut(s) 226
BsnI GGCC 2 cut(s) 117, 121
Bsp143I GATC 1 cut(s) 44
Bsp68I TCGCGA 1 cut(s) 43
BspANI GGCC 2 cut(s) 117, 121
BspFNI CGCG 1 cut(s) 43
BsrDI GCAATG 1 cut(s) 153
BsrFI RCCGGY 1 cut(s) 117
BsrI ACTGG 2 cut(s) 125, 188
BssAI RCCGGY 1 cut(s) 117
BssECI CCNNGG 1 cut(s) 112
BssMI GATC 1 cut(s) 44
BssT1I CCWWGG 1 cut(s) 112
Bst2UI CCWGG 1 cut(s) 104
Bst6I CTCTTC 2 cut(s) 61, 167
BstC8I GCNNGC 1 cut(s) 119
BstFNI CGCG 1 cut(s) 43
BstKTI GATC 1 cut(s) 47
BstMBI GATC 1 cut(s) 44
BstMCI CGRYCG 1 cut(s) 47
BstMWI GCNNNNNNNGC 1 cut(s) 210
BstNI CCWGG 1 cut(s) 104
BstSCI CCNGG 1 cut(s) 102
BstUI CGCG 1 cut(s) 43
BsuI GTATCC 1 cut(s) 110
BsuRI GGCC 2 cut(s) 117, 121
BtuMI TCGCGA 1 cut(s) 43
Cac8I GCNNGC 1 cut(s) 119
CaiI CAGNNNCTG 1 cut(s) 131
Cfr10I RCCGGY 1 cut(s) 117
Cfr13I GGNCC 2 cut(s) 36, 106
CviAII CATG 2 cut(s) 8, 229
CviJI RGCY 4 cut(s) 87, 117, 121, 139
CviKI_1 RGCY 4 cut(s) 87, 117, 121, 139
DpnI GATC 1 cut(s) 46
DpnII GATC 1 cut(s) 44
Eam1104I CTCTTC 2 cut(s) 61, 167
EarI CTCTTC 2 cut(s) 61, 167
Eco130I CCWWGG 1 cut(s) 112
Eco47I GGWCC 2 cut(s) 36, 106
EcoO109I RGGNCCY 2 cut(s) 36, 106
EcoRII CCWGG 1 cut(s) 102
EcoT14I CCWWGG 1 cut(s) 112
ErhI CCWWGG 1 cut(s) 112
FaeI CATG 2 cut(s) 11, 232
FaiI YATR 5 cut(s) 9, 202, 215, 230, 254
FaqI GGGAC 1 cut(s) 226
FatI CATG 2 cut(s) 7, 228
FseI GGCCGGCC 1 cut(s) 121
FspBI CTAG 1 cut(s) 268
GsuI CTGGAG 1 cut(s) 108
HaeIII GGCC 2 cut(s) 117, 121
HapII CCGG 1 cut(s) 118
Hin1II CATG 2 cut(s) 11, 232
HinfI GANTC 2 cut(s) 78, 257
HpaII CCGG 1 cut(s) 118
Hpy188I TCNGA 1 cut(s) 156
Hpy188III TCNNGA 1 cut(s) 42
HpyCH4V TGCA 5 cut(s) 14, 71, 146, 191, 204
HpyF10VI GCNNNNNNNGC 1 cut(s) 210
Hsp92II CATG 2 cut(s) 11, 232
KroI GCCGGC 1 cut(s) 117
KroNI GCCGGC 1 cut(s) 119
Kzo9I GATC 1 cut(s) 44
LmnI GCTCC 1 cut(s) 4
LpnPI CCDG 8 cut(s) 19, 89, 116, 117, 131, 138, 169, 181
MaeI CTAG 1 cut(s) 268
MalI GATC 1 cut(s) 46
MboI GATC 1 cut(s) 44
MboII GAAGA 4 cut(s) 48, 184, 244, 252
MluCI AATT 1 cut(s) 66
MnlI CCTC 5 cut(s) 49, 64, 67, 119, 132
MroNI GCCGGC 1 cut(s) 117
MslI CAYNNNNRTG 1 cut(s) 233
MspI CCGG 1 cut(s) 118
MspR9I CCNGG 1 cut(s) 104
MvaI CCWGG 1 cut(s) 104
MvnI CGCG 1 cut(s) 43
MwoI GCNNNNNNNGC 1 cut(s) 210
NaeI GCCGGC 1 cut(s) 119
NdeII GATC 1 cut(s) 44
NgoMIV GCCGGC 1 cut(s) 117
NlaIII CATG 2 cut(s) 11, 232
NruI TCGCGA 1 cut(s) 43
PdiI GCCGGC 1 cut(s) 119
PfeI GAWTC 2 cut(s) 78, 257
PflMI CCANNNNNTGG 1 cut(s) 131
Ple19I CGATCG 1 cut(s) 47
PpuMI RGGWCCY 2 cut(s) 36, 106
Psp5II RGGWCCY 2 cut(s) 36, 106
Psp6I CCWGG 1 cut(s) 102
PspGI CCWGG 1 cut(s) 102
PspPI GGNCC 2 cut(s) 36, 106
PspPPI RGGWCCY 2 cut(s) 36, 106
PstNI CAGNNNCTG 1 cut(s) 131
PvuI CGATCG 1 cut(s) 47
RgaI GCGATCGC 1 cut(s) 47
RigI GGCCGGCC 1 cut(s) 121
RruI TCGCGA 1 cut(s) 43
RseI CAYNNNNRTG 1 cut(s) 233
Sau3AI GATC 1 cut(s) 44
Sau96I GGNCC 2 cut(s) 36, 106
ScrFI CCNGG 1 cut(s) 104
SetI ASST 3 cut(s) 38, 56, 108
SfaAI GCGATCGC 1 cut(s) 47
SgfI GCGATCGC 1 cut(s) 47
SinI GGWCC 2 cut(s) 36, 106
SmiMI CAYNNNNRTG 1 cut(s) 233
Sse9I AATT 1 cut(s) 66
SspMI CTAG 1 cut(s) 268
StyD4I CCNGG 1 cut(s) 102
StyI CCWWGG 1 cut(s) 112
TasI AATT 1 cut(s) 66
TfiI GAWTC 2 cut(s) 78, 257
TspDTI ATGAA 2 cut(s) 233, 245
TspGWI ACGGA 1 cut(s) 86
Van91I CCANNNNNTGG 1 cut(s) 131
VpaK11BI GGWCC 2 cut(s) 36, 106
XspI CTAG 1 cut(s) 268
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.