RchiOBHm_Chr5g0016771

Wall-associated receptor kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
11540375 .. 11540716
342 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ29713

Sequence Viewer

Length: 342 bp
ATGGTCTATCGAAGCACATTCTTGATGAGGAAGTTAAGGACGGACATTTTGAGACTGTCTGAAAAAATTGCTGATCTGGCCAAAAGATGTCTAAGCATGAAAGGGAGAGAAAGGCCAACTATGAGGGAAGTAGCAAGGGAGCTAGAAGGATTGCAAATTTTGCCAATGCATTCAAGGGGTGGAAAGCCTGATTCTTCTCCTAAAGAGACTGACTACTTGCTTGCATCACCTTCAAACGCTTACGTTGTCGATGTTAAGGGTGAAGGCGATGGTGGTTCCATTACAACCAGTATTGAGTACGACCAGAGCATGCAAAATCAAGCCCTAGTGTTGAGGACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

113

Amino Acids

12.71

Weight (kDa)

9.16

Isoelectric Point (pI)

53.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 78
AcsI RAATTY 1 cut(s) 156
AfaI GTAC 1 cut(s) 299
AgsI TTSAA 2 cut(s) 174, 234
AluBI AGCT 1 cut(s) 142
AluI AGCT 1 cut(s) 142
Alw26I GTCTC 2 cut(s) 46, 200
AoxI GGCC 2 cut(s) 78, 113
ApoI RAATTY 1 cut(s) 156
ArsI GACNNNNNNTTYG 2 cut(s) 31, 63
AsuHPI GGTGA 2 cut(s) 219, 272
BalI TGGCCA 1 cut(s) 80
BccI CCATC 1 cut(s) 263
BcoDI GTCTC 2 cut(s) 46, 200
BfaI CTAG 2 cut(s) 143, 326
BmiI GGNNCC 1 cut(s) 277
BmsI GCATC 1 cut(s) 233
Bse1I ACTGG 1 cut(s) 288
BseNI ACTGG 1 cut(s) 288
BshFI GGCC 2 cut(s) 80, 115
BsmAI GTCTC 2 cut(s) 46, 200
BsmI GAATGC 1 cut(s) 169
BsnI GGCC 2 cut(s) 80, 115
Bsp143I GATC 1 cut(s) 73
BspANI GGCC 2 cut(s) 80, 115
BspLI GGNNCC 1 cut(s) 277
BsrI ACTGG 1 cut(s) 288
BssMI GATC 1 cut(s) 73
Bst4CI ACNGT 1 cut(s) 57
BstAPI GCANNNNNTGC 1 cut(s) 160
BstC8I GCNNGC 2 cut(s) 222, 311
BstDEI CTNAG 1 cut(s) 92
BstKTI GATC 1 cut(s) 76
BstMAI GTCTC 2 cut(s) 46, 200
BstMBI GATC 1 cut(s) 73
BstMWI GCNNNNNNNGC 2 cut(s) 77, 160
BstNSI RCATGY 1 cut(s) 313
BsuRI GGCC 2 cut(s) 80, 115
BtgZI GCGATG 1 cut(s) 282
Cac8I GCNNGC 2 cut(s) 222, 311
Csp6I GTAC 1 cut(s) 298
CviAII CATG 2 cut(s) 97, 310
CviJI RGCY 5 cut(s) 80, 115, 142, 187, 323
CviKI_1 RGCY 5 cut(s) 80, 115, 142, 187, 323
CviQI GTAC 1 cut(s) 298
DdeI CTNAG 1 cut(s) 92
DpnI GATC 1 cut(s) 75
DpnII GATC 1 cut(s) 73
EaeI YGGCCR 1 cut(s) 78
EcoT22I ATGCAT 1 cut(s) 171
FaeI CATG 2 cut(s) 100, 313
FaiI YATR 3 cut(s) 98, 122, 311
FatI CATG 2 cut(s) 96, 309
FspBI CTAG 2 cut(s) 143, 326
HaeIII GGCC 2 cut(s) 80, 115
Hin1II CATG 2 cut(s) 100, 313
HinfI GANTC 1 cut(s) 191
HphI GGTGA 2 cut(s) 219, 272
Hpy188I TCNGA 1 cut(s) 61
Hpy188III TCNNGA 1 cut(s) 22
HpyAV CCTTC 3 cut(s) 140, 240, 257
HpyCH4III ACNGT 1 cut(s) 57
HpyCH4IV ACGT 1 cut(s) 243
HpyCH4V TGCA 4 cut(s) 154, 169, 224, 313
HpyF10VI GCNNNNNNNGC 2 cut(s) 77, 160
HpyF3I CTNAG 1 cut(s) 92
HpySE526I ACGT 1 cut(s) 243
Hsp92II CATG 2 cut(s) 100, 313
Kzo9I GATC 1 cut(s) 73
LmnI GCTCC 1 cut(s) 139
LpnPI CCDG 4 cut(s) 62, 201, 301, 317
LweI GCATC 1 cut(s) 233
MaeI CTAG 2 cut(s) 143, 326
MaeII ACGT 1 cut(s) 243
MalI GATC 1 cut(s) 75
MboI GATC 1 cut(s) 73
MboII GAAGA 1 cut(s) 186
MlsI TGGCCA 1 cut(s) 80
MluCI AATT 2 cut(s) 66, 156
MluNI TGGCCA 1 cut(s) 80
MnlI CCTC 3 cut(s) 21, 117, 327
Mox20I TGGCCA 1 cut(s) 80
Mph1103I ATGCAT 1 cut(s) 171
MscI TGGCCA 1 cut(s) 80
MseI TTAA 2 cut(s) 35, 255
Msp20I TGGCCA 1 cut(s) 80
Mva1269I GAATGC 1 cut(s) 169
MwoI GCNNNNNNNGC 2 cut(s) 77, 160
NdeII GATC 1 cut(s) 73
NlaIII CATG 2 cut(s) 100, 313
NlaIV GGNNCC 1 cut(s) 277
NsiI ATGCAT 1 cut(s) 171
NspI RCATGY 1 cut(s) 313
PaeI GCATGC 1 cut(s) 313
PctI GAATGC 1 cut(s) 169
PfeI GAWTC 1 cut(s) 191
PspN4I GGNNCC 1 cut(s) 277
RsaI GTAC 1 cut(s) 299
RsaNI GTAC 1 cut(s) 298
SaqAI TTAA 2 cut(s) 35, 255
Sau3AI GATC 1 cut(s) 73
SetI ASST 3 cut(s) 144, 232, 246
SfaNI GCATC 1 cut(s) 233
SphI GCATGC 1 cut(s) 313
Sse9I AATT 2 cut(s) 66, 156
SspMI CTAG 2 cut(s) 143, 326
TaaI ACNGT 1 cut(s) 57
TaiI ACGT 1 cut(s) 246
TaqI TCGA 2 cut(s) 10, 249
TasI AATT 2 cut(s) 66, 156
TfiI GAWTC 1 cut(s) 191
Tru1I TTAA 2 cut(s) 35, 255
Tru9I TTAA 2 cut(s) 35, 255
TspDTI ATGAA 1 cut(s) 113
TspGWI ACGGA 1 cut(s) 56
XapI RAATTY 1 cut(s) 156
XceI RCATGY 1 cut(s) 313
XspI CTAG 2 cut(s) 143, 326
Zsp2I ATGCAT 1 cut(s) 171
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.