Rmu_sc0003630.1_g000009
ERF Family

DNA RNA polymerases superfamily protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003630.1
Physical Location & Seq
Forward (+)
32514 .. 33035
522 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003630.1_g000009.1.cds

Sequence Viewer

Length: 522 bp
ctgacagagaagagtgatgtctgggttgtccttgtggagctaataacgagtcaagtggcaatttcttacaagaagcctgaggcagagagaaacctagcaaacgtttttgttacgtcggtggtagagaatcgcttggctcagattcttgatcatgaaataatcaaagagggaagttttgaaatagctgaacaagtggcccatctcgccaaaagatgtttaagtttgaaaggaggggataggcctaccatgaaagaagtagctatggagctagagggtattttggcagttatggcaaagcatccggggggaaagcctgactcctctcctaaagagaccgactacttgcttgcggagtcaccttcaaacgtttacgctgttgatgttagaggtgatgaaggtgaagtcatgaccagtatcgattacgaccagagcatgcagaatcaatcccagatgatgaagccttatgacggtgggagcactacaacaaaattgggtattaatgactactgcattggtcactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

173

Amino Acids

19.03

Weight (kDa)

4.83

Isoelectric Point (pI)

34.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 350
AclI AACGTT 2 cut(s) 102, 366
AfiI CCNNNNNNNGG 1 cut(s) 467
AgsI TTSAA 3 cut(s) 179, 226, 363
AluBI AGCT 4 cut(s) 40, 185, 260, 268
AluI AGCT 4 cut(s) 40, 185, 260, 268
Alw21I GWGCWC 1 cut(s) 479
Alw26I GTCTC 1 cut(s) 326
AoxI GGCC 2 cut(s) 195, 239
AseI ATTAAT 1 cut(s) 498
AspS9I GGNCC 1 cut(s) 196
AsuC2I CCSGG 1 cut(s) 303
AsuHPI GGTGA 3 cut(s) 348, 401, 410
AxyI CCTNAGG 1 cut(s) 78
Bbv12I GWGCWC 1 cut(s) 479
BccI CCATC 1 cut(s) 207
BclI TGATCA 1 cut(s) 148
BcnI CCSGG 1 cut(s) 303
BcoDI GTCTC 1 cut(s) 326
BfaI CTAG 2 cut(s) 95, 269
Bme1390I CCNGG 1 cut(s) 303
BmgT120I GGNCC 1 cut(s) 196
BmrFI CCNGG 1 cut(s) 303
BmsI GCATC 1 cut(s) 307
BpuMI CCSGG 1 cut(s) 303
Bsa29I ATCGAT 1 cut(s) 417
BsaI GGTCTC 1 cut(s) 326
BsaJI CCNNGG 1 cut(s) 302
Bsc4I CCNNNNNNNGG 1 cut(s) 467
Bse1I ACTGG 1 cut(s) 411
Bse21I CCTNAGG 1 cut(s) 78
BseCI ATCGAT 1 cut(s) 417
BseDI CCNNGG 1 cut(s) 302
BseGI GGATG 1 cut(s) 298
BseLI CCNNNNNNNGG 1 cut(s) 467
BseMII CTCAG 2 cut(s) 69, 152
BseNI ACTGG 1 cut(s) 411
BseRI GAGGAG 1 cut(s) 310
BshFI GGCC 2 cut(s) 197, 241
BshVI ATCGAT 1 cut(s) 417
BsiHKAI GWGCWC 1 cut(s) 479
BsiSI CCGG 1 cut(s) 302
BslI CCNNNNNNNGG 1 cut(s) 467
BsmAI GTCTC 1 cut(s) 326
BsnI GGCC 2 cut(s) 197, 241
Bso31I GGTCTC 1 cut(s) 326
Bsp1286I GDGCHC 1 cut(s) 479
Bsp143I GATC 1 cut(s) 148
BspACI CCGC 1 cut(s) 350
BspANI GGCC 2 cut(s) 197, 241
BspCNI CTCAG 2 cut(s) 70, 151
BspDI ATCGAT 1 cut(s) 417
BspHI TCATGA 2 cut(s) 151, 405
BspTNI GGTCTC 1 cut(s) 326
BsrI ACTGG 1 cut(s) 411
BssECI CCNNGG 1 cut(s) 302
BssMI GATC 1 cut(s) 148
Bst4CI ACNGT 1 cut(s) 470
Bst6I CTCTTC 1 cut(s) 5
BstC8I GCNNGC 2 cut(s) 348, 434
BstDEI CTNAG 2 cut(s) 78, 138
BstF5I GGATG 1 cut(s) 298
BstKTI GATC 1 cut(s) 151
BstMAI GTCTC 1 cut(s) 326
BstMBI GATC 1 cut(s) 148
BstMWI GCNNNNNNNGC 2 cut(s) 203, 290
BstNSI RCATGY 1 cut(s) 436
BstSCI CCNGG 1 cut(s) 301
Bsu15I ATCGAT 1 cut(s) 417
Bsu36I CCTNAGG 1 cut(s) 78
BsuRI GGCC 2 cut(s) 197, 241
BsuTUI ATCGAT 1 cut(s) 417
BtsCI GGATG 1 cut(s) 298
BtsIMutI CAGTG 1 cut(s) 517
Cac8I GCNNGC 2 cut(s) 348, 434
CciI TCATGA 2 cut(s) 151, 405
Cfr13I GGNCC 1 cut(s) 196
ClaI ATCGAT 1 cut(s) 417
CviAII CATG 4 cut(s) 152, 247, 406, 433
DdeI CTNAG 2 cut(s) 78, 138
DpnI GATC 1 cut(s) 150
DpnII GATC 1 cut(s) 148
Eam1104I CTCTTC 1 cut(s) 5
EarI CTCTTC 1 cut(s) 5
Eco147I AGGCCT 1 cut(s) 241
Eco31I GGTCTC 1 cut(s) 326
Eco81I CCTNAGG 1 cut(s) 78
FaeI CATG 4 cut(s) 155, 250, 409, 436
FaiI YATR 7 cut(s) 153, 248, 263, 290, 407, 434, 465
FatI CATG 4 cut(s) 151, 246, 405, 432
FbaI TGATCA 1 cut(s) 148
FokI GGATG 1 cut(s) 285
FspBI CTAG 2 cut(s) 95, 269
HaeIII GGCC 2 cut(s) 197, 241
HapII CCGG 1 cut(s) 302
Hin1II CATG 4 cut(s) 155, 250, 409, 436
HinfI GANTC 6 cut(s) 49, 127, 142, 317, 353, 439
HpaII CCGG 1 cut(s) 302
HphI GGTGA 3 cut(s) 348, 401, 410
Hpy166II GTNNAC 1 cut(s) 370
Hpy188I TCNGA 1 cut(s) 141
Hpy188III TCNNGA 3 cut(s) 146, 152, 406
Hpy8I GTNNAC 1 cut(s) 370
Hpy99I CGWCG 1 cut(s) 118
HpyAV CCTTC 2 cut(s) 369, 389
HpyCH4III ACNGT 1 cut(s) 470
HpyCH4IV ACGT 3 cut(s) 102, 113, 366
HpyCH4V TGCA 2 cut(s) 436, 510
HpyF10VI GCNNNNNNNGC 2 cut(s) 203, 290
HpyF3I CTNAG 2 cut(s) 78, 138
HpySE526I ACGT 3 cut(s) 102, 113, 366
Hsp92II CATG 4 cut(s) 155, 250, 409, 436
Ksp22I TGATCA 1 cut(s) 148
Kzo9I GATC 1 cut(s) 148
LmnI GCTCC 3 cut(s) 37, 265, 474
LpnPI CCDG 7 cut(s) 7, 90, 315, 327, 424, 440, 461
LweI GCATC 1 cut(s) 307
MaeI CTAG 2 cut(s) 95, 269
MaeII ACGT 3 cut(s) 102, 113, 366
MaeIII GTNAC 3 cut(s) 109, 354, 515
MalI GATC 1 cut(s) 150
MboI GATC 1 cut(s) 148
MboII GAAGA 1 cut(s) 22
MhlI GDGCHC 1 cut(s) 479
MluCI AATT 2 cut(s) 60, 488
MlyI GAGTC 3 cut(s) 58, 311, 362
MnlI CCTC 6 cut(s) 73, 160, 224, 265, 331, 380
MseI TTAA 2 cut(s) 218, 498
MspI CCGG 1 cut(s) 302
MspR9I CCNGG 1 cut(s) 303
MwoI GCNNNNNNNGC 2 cut(s) 203, 290
NciI CCSGG 1 cut(s) 303
NdeII GATC 1 cut(s) 148
NlaIII CATG 4 cut(s) 155, 250, 409, 436
NmuCI GTSAC 2 cut(s) 354, 515
NspI RCATGY 1 cut(s) 436
PaeI GCATGC 1 cut(s) 436
PagI TCATGA 2 cut(s) 151, 405
PceI AGGCCT 1 cut(s) 241
PfeI GAWTC 3 cut(s) 127, 142, 439
PleI GAGTC 3 cut(s) 57, 311, 361
PpsI GAGTC 3 cut(s) 57, 311, 361
PshBI ATTAAT 1 cut(s) 498
Psp1406I AACGTT 2 cut(s) 102, 366
PspPI GGNCC 1 cut(s) 196
SaqAI TTAA 2 cut(s) 218, 498
Sau3AI GATC 1 cut(s) 148
Sau96I GGNCC 1 cut(s) 196
SchI GAGTC 3 cut(s) 58, 311, 362
ScrFI CCNGG 1 cut(s) 303
SduI GDGCHC 1 cut(s) 479
SfaNI GCATC 1 cut(s) 307
SphI GCATGC 1 cut(s) 436
Sse9I AATT 2 cut(s) 60, 488
SseBI AGGCCT 1 cut(s) 241
SsiI CCGC 1 cut(s) 350
SspMI CTAG 2 cut(s) 95, 269
StuI AGGCCT 1 cut(s) 241
StyD4I CCNGG 1 cut(s) 301
TaaI ACNGT 1 cut(s) 470
TaiI ACGT 3 cut(s) 105, 116, 369
TaqI TCGA 1 cut(s) 417
TaqII GACCGA 1 cut(s) 350
TasI AATT 2 cut(s) 60, 488
TfiI GAWTC 3 cut(s) 127, 142, 439
Tru1I TTAA 2 cut(s) 218, 498
Tru9I TTAA 2 cut(s) 218, 498
TseFI GTSAC 2 cut(s) 354, 515
Tsp45I GTSAC 2 cut(s) 354, 515
TspDTI ATGAA 4 cut(s) 168, 263, 408, 470
VspI ATTAAT 1 cut(s) 498
XceI RCATGY 1 cut(s) 436
XspI CTAG 2 cut(s) 95, 269
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.