RchiOBHm_Chr5g0036631

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
30818006 .. 30820182
2177 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ31544

Sequence Viewer

Length: 234 bp
ATGCTCGTTTCAGATGGTTGTTGTTTGACTGGAGAATGTTTATCTGAACATAGGTGGCTGCATTACTTCAAATCACACAGAACTATCACATACAAGAGTAAAGGTTTGGTACTTCATATGGTATGGCTGGTAGAAGTGATAAGGGGGAGTAGGATTTGGAAAGATGACGAAGCATCTCTGTTGGGAGAGCAGTTAAGAGCACCAGATGATATGGTATTTTCAGATGTGGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

8.94

Weight (kDa)

5.74

Isoelectric Point (pI)

40.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 111
AgsI TTSAA 1 cut(s) 70
Alw21I GWGCWC 1 cut(s) 202
ApeKI GCWGC 1 cut(s) 58
Bbv12I GWGCWC 1 cut(s) 202
BbvI GCAGC 1 cut(s) 45
BccI CCATC 1 cut(s) 8
BisI GCNGC 1 cut(s) 59
BlsI GCNGC 1 cut(s) 60
BmsI GCATC 1 cut(s) 182
BpmI CTGGAG 1 cut(s) 51
Bse1I ACTGG 1 cut(s) 34
BseNI ACTGG 1 cut(s) 34
BseXI GCAGC 1 cut(s) 45
BsiHKAI GWGCWC 1 cut(s) 202
Bsp1286I GDGCHC 1 cut(s) 202
BsrI ACTGG 1 cut(s) 34
BstV1I GCAGC 1 cut(s) 45
Csp6I GTAC 1 cut(s) 110
CviJI RGCY 2 cut(s) 58, 127
CviKI_1 RGCY 2 cut(s) 58, 127
CviQI GTAC 1 cut(s) 110
FaiI YATR 6 cut(s) 51, 91, 117, 119, 124, 212
FauNDI CATATG 1 cut(s) 117
Fnu4HI GCNGC 1 cut(s) 59
Fsp4HI GCNGC 1 cut(s) 59
GluI GCNGC 1 cut(s) 59
GsuI CTGGAG 1 cut(s) 51
Hpy188I TCNGA 3 cut(s) 13, 46, 223
HpyCH4V TGCA 1 cut(s) 61
LpnPI CCDG 3 cut(s) 15, 113, 216
Lsp1109I GCAGC 1 cut(s) 45
LweI GCATC 1 cut(s) 182
MhlI GDGCHC 1 cut(s) 202
MseI TTAA 1 cut(s) 194
NdeI CATATG 1 cut(s) 117
PkrI GCNGC 1 cut(s) 60
RsaI GTAC 1 cut(s) 111
RsaNI GTAC 1 cut(s) 110
SaqAI TTAA 1 cut(s) 194
SatI GCNGC 1 cut(s) 59
SduI GDGCHC 1 cut(s) 202
SetI ASST 2 cut(s) 56, 106
SfaNI GCATC 1 cut(s) 182
SgeI CNNG 5 cut(s) 17, 42, 106, 140, 215
Tru1I TTAA 1 cut(s) 194
Tru9I TTAA 1 cut(s) 194
TseI GCWGC 1 cut(s) 58
TspDTI ATGAA 1 cut(s) 104
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.