Rh3BG239800

Protein STRUBBELIG-RECEPTOR FAMILY 2-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Forward (+)
22622413 .. 22628274
5862 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG239800.1

Sequence Viewer

Length: 324 bp
ATGCCTGTTCCTGAATCTTTTCATCTTTCTTCTTCCAGGGATATTAGTTCCAATACCATCGGTAGTGAAATTCCATATGTCTTACCCCCCAATGCGACTCATATGAATCTAAGCCACAATTTGTCCTCAACTCCAAGACTTGCTGGGAACCGAGTTCCCGTGCTTAGGACAGGGATTACTGAAGAATCTCACAAACATCATAATAACGCTCTGTTTACAGATGGTAATGAGGATGGTATTCGAGGCTTGGTGTTGAAAGAGGAATGCAAGCTAGTGACTTATATTTGGCTAAGTTATGTTTACCGCAGTATTATTTCTACTTAA

Protein Analysis

107

Amino Acids

11.93

Weight (kDa)

6.57

Isoelectric Point (pI)

58.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 304
AcsI RAATTY 1 cut(s) 69
AcuI CTGAAG 1 cut(s) 201
AfiI CCNNNNNNNGG 1 cut(s) 165
AgsI TTSAA 1 cut(s) 256
AjnI CCWGG 1 cut(s) 35
AluBI AGCT 1 cut(s) 271
AluI AGCT 1 cut(s) 271
ApoI RAATTY 1 cut(s) 69
Asp700I GAANNNNTTC 1 cut(s) 18
BccI CCATC 3 cut(s) 65, 215, 227
BciT130I CCWGG 1 cut(s) 37
BfaI CTAG 1 cut(s) 272
Bme1390I CCNGG 1 cut(s) 37
BmiI GGNNCC 1 cut(s) 149
BmrFI CCNGG 1 cut(s) 37
Bpu10I CCTNAGC 1 cut(s) 164
BsaJI CCNNGG 1 cut(s) 36
Bsc4I CCNNNNNNNGG 1 cut(s) 165
BseBI CCWGG 1 cut(s) 37
BseDI CCNNGG 1 cut(s) 36
BseGI GGATG 1 cut(s) 238
BseLI CCNNNNNNNGG 1 cut(s) 165
BseYI CCCAGC 1 cut(s) 143
BslI CCNNNNNNNGG 1 cut(s) 165
BsmI GAATGC 1 cut(s) 269
BspACI CCGC 1 cut(s) 304
BspLI GGNNCC 1 cut(s) 149
BssECI CCNNGG 1 cut(s) 36
Bst2UI CCWGG 1 cut(s) 37
BstC8I GCNNGC 1 cut(s) 269
BstDEI CTNAG 3 cut(s) 110, 164, 290
BstF5I GGATG 1 cut(s) 238
BstNI CCWGG 1 cut(s) 37
BstSCI CCNGG 1 cut(s) 35
BtsCI GGATG 1 cut(s) 238
Cac8I GCNNGC 1 cut(s) 269
CviJI RGCY 4 cut(s) 114, 246, 271, 289
CviKI_1 RGCY 4 cut(s) 114, 246, 271, 289
DdeI CTNAG 3 cut(s) 110, 164, 290
Eco57I CTGAAG 1 cut(s) 201
EcoRII CCWGG 1 cut(s) 35
FaiI YATR 7 cut(s) 76, 78, 102, 104, 201, 282, 297
FauNDI CATATG 2 cut(s) 76, 102
FokI GGATG 1 cut(s) 245
FspBI CTAG 1 cut(s) 272
GsaI CCCAGC 1 cut(s) 147
HinfI GANTC 4 cut(s) 14, 97, 106, 185
Hpy166II GTNNAC 2 cut(s) 216, 301
Hpy188III TCNNGA 1 cut(s) 11
Hpy8I GTNNAC 2 cut(s) 216, 301
HpyCH4V TGCA 1 cut(s) 267
HpyF3I CTNAG 3 cut(s) 110, 164, 290
LpnPI CCDG 6 cut(s) 18, 22, 24, 49, 129, 156
MaeI CTAG 1 cut(s) 272
MaeIII GTNAC 1 cut(s) 274
MboII GAAGA 3 cut(s) 21, 24, 194
MluCI AATT 2 cut(s) 69, 118
MlyI GAGTC 1 cut(s) 91
MnlI CCTC 4 cut(s) 136, 223, 236, 253
MroXI GAANNNNTTC 1 cut(s) 18
MseI TTAA 1 cut(s) 322
MspR9I CCNGG 1 cut(s) 37
Mva1269I GAATGC 1 cut(s) 269
MvaI CCWGG 1 cut(s) 37
NdeI CATATG 2 cut(s) 76, 102
NlaIV GGNNCC 1 cut(s) 149
NmuCI GTSAC 1 cut(s) 274
PctI GAATGC 1 cut(s) 269
PdmI GAANNNNTTC 1 cut(s) 18
PfeI GAWTC 3 cut(s) 14, 106, 185
PleI GAGTC 1 cut(s) 91
PpsI GAGTC 1 cut(s) 91
Psp6I CCWGG 1 cut(s) 35
PspFI CCCAGC 1 cut(s) 143
PspGI CCWGG 1 cut(s) 35
PspN4I GGNNCC 1 cut(s) 149
SaqAI TTAA 1 cut(s) 322
SchI GAGTC 1 cut(s) 91
ScrFI CCNGG 1 cut(s) 37
SetI ASST 1 cut(s) 273
Sse9I AATT 2 cut(s) 69, 118
SsiI CCGC 1 cut(s) 304
SspMI CTAG 1 cut(s) 272
StyD4I CCNGG 1 cut(s) 35
TaqI TCGA 1 cut(s) 241
TasI AATT 2 cut(s) 69, 118
TfiI GAWTC 3 cut(s) 14, 106, 185
Tru1I TTAA 1 cut(s) 322
Tru9I TTAA 1 cut(s) 322
TseFI GTSAC 1 cut(s) 274
Tsp45I GTSAC 1 cut(s) 274
TspDTI ATGAA 2 cut(s) 11, 119
XapI RAATTY 1 cut(s) 69
XmnI GAANNNNTTC 1 cut(s) 18
XspI CTAG 1 cut(s) 272
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.