RchiOBHm_Chr5g0039701

Predicted integral membrane zinc-ribbon metal-binding protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
34404674 .. 34404912
239 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ31826

Sequence Viewer

Length: 192 bp
ATGCAGAAGTATGATGCTGACCCAGCGGCAAAGATAGCTGGTGCAACTGTCCTGGGCATCCAAGTTGGGTGTGGATTGCATTCAGGAGATGAATCTAGAGCTAATGTTGCACAAGATAATGAACTTGTCCATCAGAATCCTCAAGCATATGCTACACAAGATGGAAATTGGATTGCTCGTATTGCAGCATGA

Protein Analysis

63

Amino Acids

6.62

Weight (kDa)

4.91

Isoelectric Point (pI)

21.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 26
AjnI CCWGG 1 cut(s) 51
AluBI AGCT 2 cut(s) 38, 101
AluI AGCT 2 cut(s) 38, 101
ApeKI GCWGC 1 cut(s) 185
BccI CCATC 2 cut(s) 138, 155
BciT130I CCWGG 1 cut(s) 53
BfaI CTAG 1 cut(s) 96
BisI GCNGC 2 cut(s) 27, 186
BlsI GCNGC 2 cut(s) 28, 187
Bme1390I CCNGG 1 cut(s) 53
BmrFI CCNGG 1 cut(s) 53
BmsI GCATC 2 cut(s) 4, 66
BpuEI CTTGAG 1 cut(s) 126
BsaJI CCNNGG 1 cut(s) 52
BseBI CCWGG 1 cut(s) 53
BseDI CCNNGG 1 cut(s) 52
BseGI GGATG 1 cut(s) 57
BseYI CCCAGC 1 cut(s) 22
BsmI GAATGC 1 cut(s) 79
BspACI CCGC 1 cut(s) 26
BssECI CCNNGG 1 cut(s) 52
Bst2UI CCWGG 1 cut(s) 53
Bst4CI ACNGT 1 cut(s) 49
BstF5I GGATG 1 cut(s) 57
BstMWI GCNNNNNNNGC 4 cut(s) 23, 35, 107, 182
BstNI CCWGG 1 cut(s) 53
BstSCI CCNGG 1 cut(s) 51
BtsCI GGATG 1 cut(s) 57
CviAII CATG 1 cut(s) 189
CviJI RGCY 2 cut(s) 38, 101
CviKI_1 RGCY 2 cut(s) 38, 101
EcoRII CCWGG 1 cut(s) 51
FaeI CATG 1 cut(s) 192
FaiI YATR 4 cut(s) 12, 148, 150, 190
FatI CATG 1 cut(s) 188
FauNDI CATATG 1 cut(s) 148
Fnu4HI GCNGC 2 cut(s) 27, 186
FokI GGATG 1 cut(s) 44
Fsp4HI GCNGC 2 cut(s) 27, 186
FspBI CTAG 1 cut(s) 96
GluI GCNGC 2 cut(s) 27, 186
GsaI CCCAGC 1 cut(s) 26
Hin1II CATG 1 cut(s) 192
HinfI GANTC 2 cut(s) 92, 136
Hpy188I TCNGA 1 cut(s) 135
Hpy188III TCNNGA 2 cut(s) 84, 96
HpyCH4III ACNGT 1 cut(s) 49
HpyCH4V TGCA 5 cut(s) 4, 44, 79, 110, 185
HpyF10VI GCNNNNNNNGC 4 cut(s) 23, 35, 107, 182
Hsp92II CATG 1 cut(s) 192
LpnPI CCDG 5 cut(s) 24, 36, 38, 65, 69
LweI GCATC 2 cut(s) 4, 66
MaeI CTAG 1 cut(s) 96
MluCI AATT 1 cut(s) 166
MnlI CCTC 1 cut(s) 150
MspA1I CMGCKG 1 cut(s) 26
MspR9I CCNGG 1 cut(s) 53
Mva1269I GAATGC 1 cut(s) 79
MvaI CCWGG 1 cut(s) 53
MwoI GCNNNNNNNGC 4 cut(s) 23, 35, 107, 182
NdeI CATATG 1 cut(s) 148
NlaIII CATG 1 cut(s) 192
PctI GAATGC 1 cut(s) 79
PfeI GAWTC 2 cut(s) 92, 136
PkrI GCNGC 2 cut(s) 28, 187
Psp6I CCWGG 1 cut(s) 51
PspFI CCCAGC 1 cut(s) 22
PspGI CCWGG 1 cut(s) 51
SatI GCNGC 2 cut(s) 27, 186
ScrFI CCNGG 1 cut(s) 53
SetI ASST 2 cut(s) 40, 103
SfaNI GCATC 2 cut(s) 4, 66
SmlI CTYRAG 1 cut(s) 141
SmoI CTYRAG 1 cut(s) 141
Sse9I AATT 1 cut(s) 166
SsiI CCGC 1 cut(s) 26
SspMI CTAG 1 cut(s) 96
StyD4I CCNGG 1 cut(s) 51
TaaI ACNGT 1 cut(s) 49
TasI AATT 1 cut(s) 166
TauI GCSGC 1 cut(s) 29
TfiI GAWTC 2 cut(s) 92, 136
TseI GCWGC 1 cut(s) 185
TspDTI ATGAA 2 cut(s) 105, 135
XbaI TCTAGA 1 cut(s) 95
XcmI CCANNNNNNNNNTGG 1 cut(s) 68
XspI CTAG 1 cut(s) 96
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.