Rh7BG322900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Reverse (-)
31701177 .. 31701590
414 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG322900.1

Sequence Viewer

Length: 414 bp
ATGGTGATTTGCATACCATTATTACATGTTTCAATGGTGGCAATAGAGTTTGAACCTTCTGCAACTGAGATTGAATCTTACACAATCTTGCTCATTACTTGTCTCTCTGTATCCTGTCTATTAGTCTATCTATCAGTCGAATGTCTTATTCTATTTTGCTGCACACGAATAATATATAAGTCAGACAGAGAGAGAACATGGAAAAATATGTATTATAATTCAATCCCTTTCCACTGTAATACTCACAGAAAGCATAATGATATCCGCAGTATGAGATTGATCTGCTCCCATAAGCAATTAGCTAGGTTATGGCCTGGTCGGGTGTATCTTGCTTCCCCCTTGCCAGTTTTACCACCTTTCAAAGCCATAGCCATGCATGGACATTGCAAAAAAAATAAAATGCAACAGAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

137

Amino Acids

15.94

Weight (kDa)

9.15

Isoelectric Point (pI)

65.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 216
AciI CCGC 1 cut(s) 265
AflIII ACRYGT 1 cut(s) 25
AgsI TTSAA 5 cut(s) 33, 53, 74, 222, 361
AjnI CCWGG 1 cut(s) 313
AluBI AGCT 1 cut(s) 302
AluI AGCT 1 cut(s) 302
Alw26I GTCTC 1 cut(s) 107
AoxI GGCC 1 cut(s) 311
ApeKI GCWGC 1 cut(s) 159
AsuHPI GGTGA 1 cut(s) 16
BbvI GCAGC 1 cut(s) 146
BciT130I CCWGG 1 cut(s) 315
BciVI GTATCC 1 cut(s) 121
BcoDI GTCTC 1 cut(s) 107
BfaI CTAG 1 cut(s) 303
BfuI GTATCC 1 cut(s) 121
BisI GCNGC 1 cut(s) 160
BlsI GCNGC 1 cut(s) 161
Bme1390I CCNGG 1 cut(s) 315
BmrFI CCNGG 1 cut(s) 315
Bse1I ACTGG 1 cut(s) 344
Bse3DI GCAATG 1 cut(s) 382
BseBI CCWGG 1 cut(s) 315
BseMI GCAATG 1 cut(s) 382
BseMII CTCAG 1 cut(s) 57
BseNI ACTGG 1 cut(s) 344
BseXI GCAGC 1 cut(s) 146
BsgI GTGCAG 1 cut(s) 145
BshFI GGCC 1 cut(s) 313
BsmAI GTCTC 1 cut(s) 107
BsnI GGCC 1 cut(s) 313
Bsp143I GATC 1 cut(s) 279
BspACI CCGC 1 cut(s) 265
BspANI GGCC 1 cut(s) 313
BspCNI CTCAG 1 cut(s) 58
BsrDI GCAATG 1 cut(s) 382
BsrI ACTGG 1 cut(s) 344
BssMI GATC 1 cut(s) 279
Bst2UI CCWGG 1 cut(s) 315
Bst4CI ACNGT 1 cut(s) 236
BstDEI CTNAG 1 cut(s) 66
BstKTI GATC 1 cut(s) 282
BstMAI GTCTC 1 cut(s) 107
BstMBI GATC 1 cut(s) 279
BstNI CCWGG 1 cut(s) 315
BstNSI RCATGY 1 cut(s) 29
BstSCI CCNGG 1 cut(s) 313
BstV1I GCAGC 1 cut(s) 146
BsuI GTATCC 1 cut(s) 121
BsuRI GGCC 1 cut(s) 313
BtsIMutI CAGTG 1 cut(s) 232
CviAII CATG 4 cut(s) 26, 198, 373, 377
CviJI RGCY 4 cut(s) 302, 313, 365, 371
CviKI_1 RGCY 4 cut(s) 302, 313, 365, 371
DdeI CTNAG 1 cut(s) 66
DpnI GATC 1 cut(s) 281
DpnII GATC 1 cut(s) 279
Eco32I GATATC 1 cut(s) 262
EcoRII CCWGG 1 cut(s) 313
EcoRV GATATC 1 cut(s) 262
EcoT22I ATGCAT 1 cut(s) 378
FaeI CATG 4 cut(s) 29, 201, 376, 380
FatI CATG 4 cut(s) 25, 197, 372, 376
Fnu4HI GCNGC 1 cut(s) 160
Fsp4HI GCNGC 1 cut(s) 160
FspBI CTAG 1 cut(s) 303
GluI GCNGC 1 cut(s) 160
HaeIII GGCC 1 cut(s) 313
Hin1II CATG 4 cut(s) 29, 201, 376, 380
HinfI GANTC 1 cut(s) 74
HphI GGTGA 1 cut(s) 16
Hpy188I TCNGA 1 cut(s) 184
HpyAV CCTTC 1 cut(s) 66
HpyCH4III ACNGT 1 cut(s) 236
HpyCH4V TGCA 6 cut(s) 12, 62, 162, 376, 387, 403
HpyF3I CTNAG 1 cut(s) 66
Hsp92II CATG 4 cut(s) 29, 201, 376, 380
Kzo9I GATC 1 cut(s) 279
LmnI GCTCC 1 cut(s) 290
LpnPI CCDG 4 cut(s) 127, 300, 327, 357
Lsp1109I GCAGC 1 cut(s) 146
MaeI CTAG 1 cut(s) 303
MalI GATC 1 cut(s) 281
MboI GATC 1 cut(s) 279
MluCI AATT 3 cut(s) 217, 296, 409
Mph1103I ATGCAT 1 cut(s) 378
MseI TTAA 1 cut(s) 412
MslI CAYNNNNRTG 1 cut(s) 371
MspR9I CCNGG 1 cut(s) 315
MvaI CCWGG 1 cut(s) 315
NdeII GATC 1 cut(s) 279
NlaIII CATG 4 cut(s) 29, 201, 376, 380
NsiI ATGCAT 1 cut(s) 378
NspI RCATGY 1 cut(s) 29
PciI ACATGT 1 cut(s) 25
PfeI GAWTC 1 cut(s) 74
PkrI GCNGC 1 cut(s) 161
PscI ACATGT 1 cut(s) 25
PsiI TTATAA 1 cut(s) 216
Psp6I CCWGG 1 cut(s) 313
PspGI CCWGG 1 cut(s) 313
RseI CAYNNNNRTG 1 cut(s) 371
SaqAI TTAA 1 cut(s) 412
SatI GCNGC 1 cut(s) 160
Sau3AI GATC 1 cut(s) 279
ScrFI CCNGG 1 cut(s) 315
SetI ASST 4 cut(s) 58, 304, 308, 358
SmiMI CAYNNNNRTG 1 cut(s) 371
Sse9I AATT 3 cut(s) 217, 296, 409
SsiI CCGC 1 cut(s) 265
SspMI CTAG 1 cut(s) 303
StyD4I CCNGG 1 cut(s) 313
TaaI ACNGT 1 cut(s) 236
TaqI TCGA 1 cut(s) 138
TasI AATT 3 cut(s) 217, 296, 409
TfiI GAWTC 1 cut(s) 74
Tru1I TTAA 1 cut(s) 412
Tru9I TTAA 1 cut(s) 412
TscAI CASTG 1 cut(s) 239
TseI GCWGC 1 cut(s) 159
TspRI CASTG 1 cut(s) 239
XceI RCATGY 1 cut(s) 29
XspI CTAG 1 cut(s) 303
Zsp2I ATGCAT 1 cut(s) 378
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.