Rroxscaffold_3G00239770

Peptidogalycan biosysnthesis/recognition

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Forward (+)
30455730 .. 30460271
4542 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00239770.1

Sequence Viewer

Length: 264 bp
ATGGTGATTTGCATACCATTATTACATGTTTCAATGGTCGCAATAGAGTTTGAACCTTCTGCAACTGAGATTGAATCTTACACAATCTTGCTCATTACTTGTCTCTCTGGTATCTCAGAGGTGAAACCTAGAAAGATATCACTTTTAGTCATGCAGTTCACTGAGAGGGATGGATGCAATTTGGATGCTACCTCCCTTGATAAATCTAACCCATTTCTTGCTCGTGCATTTCTTGAAGCTTGGAAAAGTCAGCTTCTGCAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

87

Amino Acids

9.73

Weight (kDa)

4.94

Isoelectric Point (pI)

39.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflIII ACRYGT 1 cut(s) 25
AgsI TTSAA 4 cut(s) 33, 53, 74, 236
AluBI AGCT 2 cut(s) 239, 253
AluI AGCT 2 cut(s) 239, 253
Alw26I GTCTC 1 cut(s) 107
AlwNI CAGNNNCTG 1 cut(s) 256
AsuHPI GGTGA 2 cut(s) 16, 133
BauI CACGAG 1 cut(s) 222
BccI CCATC 1 cut(s) 164
BcoDI GTCTC 1 cut(s) 107
BfaI CTAG 1 cut(s) 129
BfmI CTRYAG 1 cut(s) 257
BmsI GCATC 2 cut(s) 164, 175
BseGI GGATG 3 cut(s) 175, 179, 190
BseMII CTCAG 3 cut(s) 57, 129, 153
BsmAI GTCTC 1 cut(s) 107
BspCNI CTCAG 3 cut(s) 58, 128, 154
BspMAI CTGCAG 1 cut(s) 261
BssSI CACGAG 1 cut(s) 222
Bst2BI CACGAG 1 cut(s) 222
BstDEI CTNAG 3 cut(s) 66, 115, 162
BstF5I GGATG 3 cut(s) 175, 179, 190
BstMAI GTCTC 1 cut(s) 107
BstNSI RCATGY 1 cut(s) 29
BstSFI CTRYAG 1 cut(s) 257
BtsCI GGATG 3 cut(s) 175, 179, 190
BtsIMutI CAGTG 1 cut(s) 159
CaiI CAGNNNCTG 1 cut(s) 256
CviAII CATG 2 cut(s) 26, 151
CviJI RGCY 2 cut(s) 239, 253
CviKI_1 RGCY 2 cut(s) 239, 253
DdeI CTNAG 3 cut(s) 66, 115, 162
Eco32I GATATC 1 cut(s) 138
EcoRV GATATC 1 cut(s) 138
FaeI CATG 2 cut(s) 29, 154
FaiI YATR 3 cut(s) 14, 27, 152
FatI CATG 2 cut(s) 25, 150
FokI GGATG 3 cut(s) 182, 186, 197
FspBI CTAG 1 cut(s) 129
Hin1II CATG 2 cut(s) 29, 154
HindIII AAGCTT 1 cut(s) 237
HinfI GANTC 1 cut(s) 74
HphI GGTGA 2 cut(s) 16, 133
Hpy166II GTNNAC 1 cut(s) 159
Hpy188I TCNGA 1 cut(s) 118
Hpy188III TCNNGA 1 cut(s) 233
Hpy8I GTNNAC 1 cut(s) 159
HpyAV CCTTC 1 cut(s) 66
HpyCH4V TGCA 6 cut(s) 12, 62, 154, 177, 227, 259
HpyF3I CTNAG 3 cut(s) 66, 115, 162
Hsp92II CATG 2 cut(s) 29, 154
LpnPI CCDG 1 cut(s) 93
LweI GCATC 2 cut(s) 164, 175
MaeI CTAG 1 cut(s) 129
MluCI AATT 1 cut(s) 178
MnlI CCTC 3 cut(s) 112, 159, 202
NlaIII CATG 2 cut(s) 29, 154
NspI RCATGY 1 cut(s) 29
PciI ACATGT 1 cut(s) 25
PfeI GAWTC 1 cut(s) 74
PscI ACATGT 1 cut(s) 25
PstI CTGCAG 1 cut(s) 261
PstNI CAGNNNCTG 1 cut(s) 256
SetI ASST 6 cut(s) 58, 123, 130, 194, 241, 255
SfaNI GCATC 2 cut(s) 164, 175
SfcI CTRYAG 1 cut(s) 257
Sse9I AATT 1 cut(s) 178
SspMI CTAG 1 cut(s) 129
TasI AATT 1 cut(s) 178
TfiI GAWTC 1 cut(s) 74
TscAI CASTG 1 cut(s) 166
TspRI CASTG 1 cut(s) 166
XceI RCATGY 1 cut(s) 29
XspI CTAG 1 cut(s) 129
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.