Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000007

Orthogroup ID

OG0016980

Physical Location & Seq

Genomic Coordinates Forward (+)

34000822 .. 34006714

Gene Structure 5893 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_7G00192690.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 153 bp

ATGCGAGTGTTCAATGAGTTGAGGAAGCTGGAAATGTTCTTCAAGGATGAGAGCAGGCATGGGGTTTCGATCATTGATTTGTACAACCTTGTTCAGCATGCTGGCAACATCCTATCAAGATTATTTGAGTGCAACTATTGGGGGGCTTCATAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005215 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005768 GO:0005770 GO:0006810 GO:0006886 GO:0008104 GO:0008150 GO:0008565 GO:0012505 GO:0015031 GO:0015833 GO:0016020 GO:0016192 GO:0016197 GO:0016482 GO:0030904 GO:0031410 GO:0031982 GO:0032991 GO:0033036 GO:0034613 GO:0042147 GO:0042886 GO:0043226 GO:0043227 GO:0043229 GO:0044424 GO:0044425 GO:0044444 GO:0044464 GO:0045184 GO:0046907 GO:0051179 GO:0051234 GO:0051641 GO:0051649 GO:0070727 GO:0071702 GO:0071705 GO:0097708 GO:0098796

KEGG Pathways

Metabolic & Signaling

ko04144 map04144

Pfam Domains

Protein Families

Vps35

Protein Analysis

50

Amino Acids

5.95

Weight (kDa)

6.71

Isoelectric Point (pI)

34.66

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Vps35	PF03635	1 - 42	3.2e-12	Vacuolar protein sorting-associated protein 35

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016980)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr2g0125801 RchiOBHm_Chr5g0039701
rosa_multiflora	Rmu_sc0002322.1_g000063 Rmu_sc0005446.1_g000007
rosa_roxburghii	Rroxscaffold_2G00133520 Rroxscaffold_3G00239770 Rroxscaffold_7G00192690
rosa_rugosa	Rorug02G0042900 Rorug02G0042900 Rorug02G0043000 Rorug05G0516600 Rorug06G0090500 Rorug06G0295400
rosa_samantha	Rh7BG322900

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AfaI	GTAC	1 cut(s)	83
AgsI	TTSAA	2 cut(s)	13, 43
AluBI	AGCT	1 cut(s)	28
AluI	AGCT	1 cut(s)	28
BseGI	GGATG	2 cut(s)	52, 108
Bsp1407I	TGTACA	1 cut(s)	81
Bsp143I	GATC	1 cut(s)	69
BsrGI	TGTACA	1 cut(s)	81
BssMI	GATC	1 cut(s)	69
BstAUI	TGTACA	1 cut(s)	81
BstC8I	GCNNGC	3 cut(s)	56, 99, 103
BstF5I	GGATG	2 cut(s)	52, 108
BstKTI	GATC	1 cut(s)	72
BstMBI	GATC	1 cut(s)	69
BstNSI	RCATGY	1 cut(s)	101
BtsCI	GGATG	2 cut(s)	52, 108
Cac8I	GCNNGC	3 cut(s)	56, 99, 103
Csp6I	GTAC	1 cut(s)	82
CviAII	CATG	2 cut(s)	59, 98
CviJI	RGCY	2 cut(s)	28, 146
CviKI_1	RGCY	2 cut(s)	28, 146
CviQI	GTAC	1 cut(s)	82
DpnI	GATC	1 cut(s)	71
DpnII	GATC	1 cut(s)	69
FaeI	CATG	2 cut(s)	62, 101
FaiI	YATR	3 cut(s)	60, 99, 151
FatI	CATG	2 cut(s)	58, 97
FokI	GGATG	2 cut(s)	59, 95
Hin1II	CATG	2 cut(s)	62, 101
Hpy188III	TCNNGA	1 cut(s)	117
HpyCH4V	TGCA	1 cut(s)	132
Hsp92II	CATG	2 cut(s)	62, 101
Kzo9I	GATC	1 cut(s)	69
LpnPI	CCDG	3 cut(s)	14, 40, 87
MalI	GATC	1 cut(s)	71
MboI	GATC	1 cut(s)	69
MboII	GAAGA	1 cut(s)	31
MnlI	CCTC	1 cut(s)	15
NdeII	GATC	1 cut(s)	69
NlaIII	CATG	2 cut(s)	62, 101
NspI	RCATGY	1 cut(s)	101
PaeI	GCATGC	1 cut(s)	101
RsaI	GTAC	1 cut(s)	83
RsaNI	GTAC	1 cut(s)	82
Sau3AI	GATC	1 cut(s)	69
SetI	ASST	2 cut(s)	30, 90
SgeI	CNNG	9 cut(s)	17, 41, 55, 67, 71, 101, 110, 114, 129
SphI	GCATGC	1 cut(s)	101
TaqI	TCGA	1 cut(s)	68
TatI	WGTACW	1 cut(s)	81
TspDTI	ATGAA	1 cut(s)	138
XceI	RCATGY	1 cut(s)	101

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.