RchiOBHm_Chr6g0256321

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
11556349 .. 11556799
451 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ22993

Sequence Viewer

Length: 177 bp
ATGTCTTTTTTTCTTTCTTTCTCTCCTTGTTCTAGCCCAATTTTTCATCAAATTTCGAGATCTACTATTAAACCTCCCATTCTCCTCCATCTCAAACACCTCACCCTCTCATCTTCATCCGAATTTTCTCTTTTTCCACCACTTCATCTTCACACTCAACCCTTGGAGGCTCGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

58

Amino Acids

6.59

Weight (kDa)

9.3

Isoelectric Point (pI)

68.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 51, 122
ApoI RAATTY 2 cut(s) 51, 122
AsuHPI GGTGA 1 cut(s) 94
BccI CCATC 1 cut(s) 96
BfaI CTAG 1 cut(s) 33
BglII AGATCT 1 cut(s) 59
BsaJI CCNNGG 1 cut(s) 162
BseDI CCNNGG 1 cut(s) 162
BseGI GGATG 1 cut(s) 116
BseRI GAGGAG 1 cut(s) 74
Bsp143I GATC 1 cut(s) 59
BssECI CCNNGG 1 cut(s) 162
BssMI GATC 1 cut(s) 59
BssT1I CCWWGG 1 cut(s) 162
BstF5I GGATG 1 cut(s) 116
BstKTI GATC 1 cut(s) 62
BstMBI GATC 1 cut(s) 59
BstX2I RGATCY 1 cut(s) 59
BstYI RGATCY 1 cut(s) 59
BtsCI GGATG 1 cut(s) 116
CviJI RGCY 2 cut(s) 36, 170
CviKI_1 RGCY 2 cut(s) 36, 170
DpnI GATC 1 cut(s) 61
DpnII GATC 1 cut(s) 59
Eco130I CCWWGG 1 cut(s) 162
EcoT14I CCWWGG 1 cut(s) 162
ErhI CCWWGG 1 cut(s) 162
FokI GGATG 1 cut(s) 103
FspBI CTAG 1 cut(s) 33
HphI GGTGA 1 cut(s) 94
Hpy188I TCNGA 1 cut(s) 121
Hpy188III TCNNGA 1 cut(s) 57
Kzo9I GATC 1 cut(s) 59
MaeI CTAG 1 cut(s) 33
MalI GATC 1 cut(s) 61
MboI GATC 1 cut(s) 59
MboII GAAGA 2 cut(s) 105, 140
MflI RGATCY 1 cut(s) 59
MluCI AATT 3 cut(s) 39, 51, 122
MnlI CCTC 5 cut(s) 84, 95, 110, 116, 160
MseI TTAA 1 cut(s) 69
NdeII GATC 1 cut(s) 59
PsuI RGATCY 1 cut(s) 59
SaqAI TTAA 1 cut(s) 69
Sau3AI GATC 1 cut(s) 59
SetI ASST 2 cut(s) 76, 102
SgeI CNNG 3 cut(s) 39, 45, 69
Sse9I AATT 3 cut(s) 39, 51, 122
SspMI CTAG 1 cut(s) 33
StyI CCWWGG 1 cut(s) 162
TaqI TCGA 2 cut(s) 56, 172
TasI AATT 3 cut(s) 39, 51, 122
Tru1I TTAA 1 cut(s) 69
Tru9I TTAA 1 cut(s) 69
TspDTI ATGAA 3 cut(s) 35, 105, 134
XapI RAATTY 2 cut(s) 51, 122
XspI CTAG 1 cut(s) 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.