RchiOBHm_Chr6g0261381

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0002136
Physical Location & Seq
Reverse (-)
16234177 .. 16238565
4389 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ23441

Sequence Viewer

Length: 150 bp
ATGCAGAAGAACATGTATAGCGTTTATGTAGAGCTGGATGAAATTAAAGCATTCAAGCTCAGGACTGAATACAATAGCAAAGAAGAACTATCTGATAAACTTGATGAAAGCAAACTGAGCAGCTCGGCAAGGTCCAGGAGGCAAGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

49

Amino Acids

5.83

Weight (kDa)

8.01

Isoelectric Point (pI)

57.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflIII ACRYGT 1 cut(s) 12
AgsI TTSAA 1 cut(s) 55
AjnI CCWGG 1 cut(s) 134
AluBI AGCT 3 cut(s) 34, 58, 123
AluI AGCT 3 cut(s) 34, 58, 123
ApeKI GCWGC 1 cut(s) 120
AspS9I GGNCC 1 cut(s) 132
AvaII GGWCC 1 cut(s) 132
BbvI GCAGC 1 cut(s) 132
BciT130I CCWGG 1 cut(s) 136
BisI GCNGC 1 cut(s) 121
BlsI GCNGC 1 cut(s) 122
Bme1390I CCNGG 1 cut(s) 136
Bme18I GGWCC 1 cut(s) 132
BmgT120I GGNCC 1 cut(s) 132
BmrFI CCNGG 1 cut(s) 136
Bpu10I CCTNAGC 1 cut(s) 59
BseBI CCWGG 1 cut(s) 136
BseGI GGATG 1 cut(s) 43
BseMII CTCAG 2 cut(s) 73, 107
BseXI GCAGC 1 cut(s) 132
BsmI GAATGC 1 cut(s) 50
BspCNI CTCAG 2 cut(s) 72, 108
Bst2UI CCWGG 1 cut(s) 136
BstDEI CTNAG 2 cut(s) 59, 116
BstF5I GGATG 1 cut(s) 43
BstMWI GCNNNNNNNGC 1 cut(s) 117
BstNI CCWGG 1 cut(s) 136
BstNSI RCATGY 1 cut(s) 16
BstSCI CCNGG 1 cut(s) 134
BstV1I GCAGC 1 cut(s) 132
BtsCI GGATG 1 cut(s) 43
Cfr13I GGNCC 1 cut(s) 132
CviAII CATG 1 cut(s) 13
CviJI RGCY 3 cut(s) 34, 58, 123
CviKI_1 RGCY 3 cut(s) 34, 58, 123
DdeI CTNAG 2 cut(s) 59, 116
Eco47I GGWCC 1 cut(s) 132
EcoRII CCWGG 1 cut(s) 134
FaeI CATG 1 cut(s) 16
FaiI YATR 3 cut(s) 14, 18, 27
FatI CATG 1 cut(s) 12
Fnu4HI GCNGC 1 cut(s) 121
FokI GGATG 1 cut(s) 50
Fsp4HI GCNGC 1 cut(s) 121
FspEI CC 6 cut(s) 20, 46, 110, 115, 121, 124
GluI GCNGC 1 cut(s) 121
Hin1II CATG 1 cut(s) 16
Hpy188I TCNGA 1 cut(s) 94
Hpy188III TCNNGA 1 cut(s) 61
HpyCH4V TGCA 1 cut(s) 4
HpyF10VI GCNNNNNNNGC 1 cut(s) 117
HpyF3I CTNAG 2 cut(s) 59, 116
Hsp92II CATG 1 cut(s) 16
LpnPI CCDG 3 cut(s) 20, 46, 121
Lsp1109I GCAGC 1 cut(s) 132
MboII GAAGA 2 cut(s) 19, 95
MluCI AATT 1 cut(s) 42
MnlI CCTC 1 cut(s) 132
MseI TTAA 1 cut(s) 45
MspR9I CCNGG 1 cut(s) 136
Mva1269I GAATGC 1 cut(s) 50
MvaI CCWGG 1 cut(s) 136
MwoI GCNNNNNNNGC 1 cut(s) 117
NlaIII CATG 1 cut(s) 16
NmeAIII GCCGAG 1 cut(s) 104
NspI RCATGY 1 cut(s) 16
PciI ACATGT 1 cut(s) 12
PctI GAATGC 1 cut(s) 50
PfoI TCCNGGA 1 cut(s) 134
PkrI GCNGC 1 cut(s) 122
PscI ACATGT 1 cut(s) 12
Psp6I CCWGG 1 cut(s) 134
PspGI CCWGG 1 cut(s) 134
PspPI GGNCC 1 cut(s) 132
SaqAI TTAA 1 cut(s) 45
SatI GCNGC 1 cut(s) 121
Sau96I GGNCC 1 cut(s) 132
ScrFI CCNGG 1 cut(s) 136
SetI ASST 4 cut(s) 36, 60, 125, 134
SgeI CNNG 7 cut(s) 25, 47, 67, 73, 113, 136, 141
SinI GGWCC 1 cut(s) 132
Sse9I AATT 1 cut(s) 42
StyD4I CCNGG 1 cut(s) 134
TasI AATT 1 cut(s) 42
Tru1I TTAA 1 cut(s) 45
Tru9I TTAA 1 cut(s) 45
TseI GCWGC 1 cut(s) 120
TspDTI ATGAA 2 cut(s) 54, 120
VpaK11BI GGWCC 1 cut(s) 132
XceI RCATGY 1 cut(s) 16
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.