Rmu_co8518461.1_g000001

At4g38062-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8518461.1
Physical Location & Seq
Reverse (-)
1641 .. 4433
2793 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8518461.1_g000001.1.cds

Sequence Viewer

Length: 2793 bp
atggagaatgtttataaagaattagacaatgtcaaagcagagatggagaggctcaaggctgagcttcgggttgagaagggaatttctgacactttgaagaaatctcacagtgagcagctgatcaagtttcaacaagctaagcgggaggttgagaaacaagctcaagagctaaatgtcaagcttgacgaaatttctcaagtaaggaaagtctctgaaaccctccaatcttgtttgcatgaaaaagaatcatctcttaggcatttgagttctttgcatgaaaagctccgagctgatcgtgagctgaagctgaaaaaactggaaggagagaataaagaattggcatttgcgtttgatgaagtttcagaaaaaaacaaacaactggagcagaatgcttgtgccagtagtcgggagattgagggccttaagagacgcttattgactacagaaagcaagtgttacgaggcagagcaaaaggcccaagcagccaaagatctgaggcagagaggtgatataataatgaacttagaggaggagaatagaaatgctcaagatcaattgaaatggaagaaagagcagtttaaacatcttgaagaagcacatagaaggctacaagatcagtttaagttgaataaagatgagtgggagagtggcaaatcagccctgctagaagagatctctttgttgcagacaagcttggattccaaaactagaattcttaaagatgtccaaaaacgtttacagatgtgcaaccaagctttagctcgtgaagaaagtatgaggaagtttttggaggttgaaatatccgaattcaaatcacgttatgaggatgtctttgctcagtgccaacaagaaaggtcaaagtttgaaagcttaactgttcaaagggatgaagagattgcgaagctaagaaactcaattggaacaagagatacatcaacaaaagaaatggaattcagaattgctcaccttgagcaagagaatcaggaattaagagaatctcttaaagagctgcaggaatctcagatcagaaatgctggggccacttcactcacaaagcttcggaacaagattaggggtttggagcaggcacacagtaactgttccagaaatttaaaagcaaaagaatctgaatggagttaccaaatagagaagatgaacggagttttaaatgggtataactctgagttgaagggtaaggagaaacaaatacaggaaactgagttggagatagagagctgccattctatgatcgaggttttaagtgaagagatttcaataatactcacaatcttcaaatcagaatttttggaggcgttctccaaaaattatgaaccaaaagccgaagtggagttgtgtggtgaaatggataacaagatctctgtatttactgcacagttggagatgaaggactgtgattttagaaaagttcttgatcttgaacaagaacatgagcaagtagaaatattgatgaagagggtaaggtccttggaacttactgaacagaggcagaataacatggaggaagagctaaaacaacacaaaaatatgctcgaggagttgtctgttcatcaactttacctgaaaggccaatttttgctgatggaaggtgagaaacaagatatttctgagactttagaaaaggtgaatcttgagttggctgagaaaattagtgaaataagtggattagaagacgaattaaagagttggaagtctagtgctgaaagcttgaaaatttgctgtgaagaaaatcaagaaaaatgtcgacaaatagaggattcaatccctgtacaaacaaagaatgaagaaatccttaagaatgaaggagaaagcctcaactccattatcaaagagaaaaacaatacacttgaagttctgcagcagcagatagtcctattagcagcaaagaatgaggaagtggaagcctgcacacaagacaaagagaaccttatccaaaatgcaaaggacaaggacagctgcatagaaaatctccacaaagatatctcacagctggaacaagagtgcataagaagagaagtggaagcgacaattctagcaaggtttgaggcagagaaatgtgttggacgagataaagagaggcttttcaaggttatcagtgagaaagatcagaacatacaaagtcttgaggtatatgctgtatcattagagcaagacttgactactgttttaactttctcctttgctgaagttgtagaaaatctagttacaattgatgtgcttactgaagctttgaagaaggccaagcatatgtcagagctacagattgaacataggaacaaaagaattgttgatttggagaaagaagtaactggttcacgccaaagattgatacatcaggaggaagccttgttccatcttaaacaacaggtacaggaacttgaagcattattggaagccaagaaactggaaaccaataaggtgatggttgaacagaggatttcggaaggcatagtcaagcagcttgaatatgaaaaagttatcctccttcaagacaccacaaagctatcaaaagaaagagagaatatttttgttcatcttgaagaattttgtgatcgtatcggtgagctcacttatgaggatacaaggatgatggatgtattagaaacaatgctgcaaggatttaaggaagaggttggaccaccagtaggtttaacagtcgataatttgctctatgattctacccaagagaatgaaagcactacaatttctgcatcagcgagaaaaattgaagctagtgctggaagattaccactgaaagagatgaatcttcggtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

930

Amino Acids

108.31

Weight (kDa)

5.14

Isoelectric Point (pI)

51.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 15
AccI GTMKAC 1 cut(s) 1762
AciI CCGC 1 cut(s) 142
AclI AACGTT 1 cut(s) 733
AcsI RAATTY 9 cut(s) 81, 189, 711, 806, 950, 1108, 1301, 1731, 2561
AcuI CTGAAG 3 cut(s) 323, 2223, 2262
AfaI GTAC 2 cut(s) 1788, 2388
AfiI CCNNNNNNNGG 2 cut(s) 405, 2663
AflII CTTAAG 2 cut(s) 422, 1811
AjuI GAANNNNNNNTTGG 4 cut(s) 320, 352, 1637, 1669
AloI GAACNNNNNNTCC 2 cut(s) 2351, 2383
Alw21I GWGCWC 1 cut(s) 2586
Alw26I GTCTC 3 cut(s) 214, 421, 1622
AlwNI CAGNNNCTG 1 cut(s) 1098
Ama87I CYCGRG 1 cut(s) 1550
AoxI GGCC 5 cut(s) 418, 474, 1038, 1585, 2256
ApoI RAATTY 9 cut(s) 81, 189, 711, 806, 950, 1108, 1301, 1731, 2561
AspS9I GGNCC 5 cut(s) 418, 475, 1038, 1482, 2654
AsuHPI GGTGA 7 cut(s) 518, 956, 1370, 1619, 1654, 2449, 2591
AvaI CYCGRG 1 cut(s) 1550
AvaII GGWCC 2 cut(s) 1482, 2654
BanII GRGCYC 1 cut(s) 2586
BauI CACGAG 1 cut(s) 762
BbsI GAAGAC 1 cut(s) 1695
Bbv12I GWGCWC 1 cut(s) 2586
BccI CCATC 5 cut(s) 37, 1594, 2379, 2434, 2602
BciVI GTATCC 1 cut(s) 2590
BclI TGATCA 1 cut(s) 120
BcoDI GTCTC 3 cut(s) 214, 421, 1622
BfaI CTAG 6 cut(s) 665, 708, 1713, 2051, 2219, 2751
BfmI CTRYAG 4 cut(s) 441, 1010, 1874, 2276
BfrI CTTAAG 2 cut(s) 422, 1811
BfuI GTATCC 1 cut(s) 2590
BglII AGATCT 3 cut(s) 490, 672, 1374
BlpI GCTNAGC 2 cut(s) 60, 138
Bme18I GGWCC 2 cut(s) 1482, 2654
BmeT110I CYCGRG 1 cut(s) 1550
BmgT120I GGNCC 5 cut(s) 418, 475, 1038, 1482, 2654
BmiI GGNNCC 1 cut(s) 1039
BmsI GCATC 1 cut(s) 2738
BpiI GAAGAC 1 cut(s) 1695
BplI GAGNNNNNCTC 4 cut(s) 1301, 1333, 1815, 1847
BpmI CTGGAG 1 cut(s) 401
Bpu1102I GCTNAGC 2 cut(s) 60, 138
BpuEI CTTGAG 7 cut(s) 38, 147, 180, 531, 989, 1670, 2162
BsaJI CCNNGG 1 cut(s) 1485
Bsc4I CCNNNNNNNGG 2 cut(s) 405, 2663
Bse1I ACTGG 6 cut(s) 321, 384, 399, 2332, 2427, 2660
BseDI CCNNGG 1 cut(s) 1485
BseGI GGATG 4 cut(s) 832, 892, 2610, 2617
BseLI CCNNNNNNNGG 2 cut(s) 405, 2663
BseMII CTCAG 8 cut(s) 51, 485, 851, 1034, 1173, 1209, 1617, 1650
BseNI ACTGG 6 cut(s) 321, 384, 399, 2332, 2427, 2660
BseRI GAGGAG 3 cut(s) 542, 545, 1568
BseYI CCCAGC 1 cut(s) 1034
BsgI GTGCAG 2 cut(s) 1374, 1909
BshFI GGCC 5 cut(s) 420, 476, 1040, 1587, 2258
BsiHKAI GWGCWC 1 cut(s) 2586
BsiHKCI CYCGRG 1 cut(s) 1550
BslI CCNNNNNNNGG 2 cut(s) 405, 2663
BsmAI GTCTC 3 cut(s) 214, 421, 1622
BsmBI CGTCTC 1 cut(s) 421
BsmI GAATGC 1 cut(s) 394
BsnI GGCC 5 cut(s) 420, 476, 1040, 1587, 2258
BsoBI CYCGRG 1 cut(s) 1550
Bsp1286I GDGCHC 1 cut(s) 2586
Bsp1407I TGTACA 1 cut(s) 1786
Bsp1720I GCTNAGC 2 cut(s) 60, 138
BspACI CCGC 1 cut(s) 142
BspANI GGCC 5 cut(s) 420, 476, 1040, 1587, 2258
BspCNI CTCAG 8 cut(s) 52, 486, 850, 1033, 1174, 1210, 1618, 1651
BspLI GGNNCC 1 cut(s) 1039
BspMAI CTGCAG 2 cut(s) 1014, 1878
BspQI GCTCTTC 1 cut(s) 1518
BspTI CTTAAG 2 cut(s) 422, 1811
BsrGI TGTACA 1 cut(s) 1786
BsrI ACTGG 6 cut(s) 321, 384, 399, 2332, 2427, 2660
BssECI CCNNGG 1 cut(s) 1485
BssSI CACGAG 1 cut(s) 762
BssT1I CCWWGG 1 cut(s) 1485
Bst2BI CACGAG 1 cut(s) 762
Bst4CI ACNGT 8 cut(s) 110, 877, 1094, 1100, 1395, 1412, 2182, 2674
Bst6I CTCTTC 7 cut(s) 663, 885, 1260, 1466, 1518, 2023, 2640
BstAFI CTTAAG 2 cut(s) 422, 1811
BstAUI TGTACA 1 cut(s) 1786
BstC8I GCNNGC 2 cut(s) 1086, 1924
BstF5I GGATG 4 cut(s) 832, 892, 2610, 2617
BstMAI GTCTC 3 cut(s) 214, 421, 1622
BstMWI GCNNNNNNNGC 2 cut(s) 280, 482
BstSFI CTRYAG 4 cut(s) 441, 1010, 1874, 2276
BstV2I GAAGAC 1 cut(s) 1695
BstX2I RGATCY 3 cut(s) 490, 672, 1374
BstXI CCANNNNNNTGG 1 cut(s) 2422
BstYI RGATCY 3 cut(s) 490, 672, 1374
BsuI GTATCC 1 cut(s) 2590
BsuRI GGCC 5 cut(s) 420, 476, 1040, 1587, 2258
BtsCI GGATG 4 cut(s) 832, 892, 2610, 2617
BtsIMutI CAGTG 4 cut(s) 115, 845, 2119, 2768
Cac8I GCNNGC 2 cut(s) 1086, 1924
CaiI CAGNNNCTG 1 cut(s) 1098
Cfr13I GGNCC 5 cut(s) 418, 475, 1038, 1482, 2654
CseI GACGC 1 cut(s) 438
Csp6I GTAC 2 cut(s) 1787, 2387
CviAII CATG 4 cut(s) 236, 275, 1448, 1516
CviQI GTAC 2 cut(s) 1787, 2387
DraI TTTAAA 3 cut(s) 580, 1113, 1167
Eam1104I CTCTTC 7 cut(s) 663, 885, 1260, 1466, 1518, 2023, 2640
EarI CTCTTC 7 cut(s) 663, 885, 1260, 1466, 1518, 2023, 2640
Ecl136II GAGCTC 1 cut(s) 2584
Eco130I CCWWGG 1 cut(s) 1485
Eco24I GRGCYC 1 cut(s) 2586
Eco32I GATATC 1 cut(s) 1999
Eco47I GGWCC 2 cut(s) 1482, 2654
Eco53kI GAGCTC 1 cut(s) 2584
Eco57I CTGAAG 3 cut(s) 323, 2223, 2262
Eco88I CYCGRG 1 cut(s) 1550
EcoICRI GAGCTC 1 cut(s) 2584
EcoO109I RGGNCCY 2 cut(s) 418, 1482
EcoRI GAATTC 3 cut(s) 711, 806, 950
EcoRV GATATC 1 cut(s) 1999
EcoT14I CCWWGG 1 cut(s) 1485
EcoT38I GRGCYC 1 cut(s) 2586
ErhI CCWWGG 1 cut(s) 1485
Esp3I CGTCTC 1 cut(s) 421
FaeI CATG 4 cut(s) 239, 278, 1451, 1519
FalI AAGNNNNNCTT 8 cut(s) 416, 448, 1794, 1826, 1929, 1961, 2082, 2114
FatI CATG 4 cut(s) 235, 274, 1447, 1515
FauI CCCGC 1 cut(s) 135
FauNDI CATATG 1 cut(s) 2265
FbaI TGATCA 1 cut(s) 120
FblI GTMKAC 1 cut(s) 1762
FokI GGATG 4 cut(s) 839, 899, 2617, 2624
FriOI GRGCYC 1 cut(s) 2586
FspBI CTAG 6 cut(s) 665, 708, 1713, 2051, 2219, 2751
GsaI CCCAGC 1 cut(s) 1038
GsuI CTGGAG 1 cut(s) 401
HaeIII GGCC 5 cut(s) 420, 476, 1040, 1587, 2258
HgaI GACGC 1 cut(s) 438
Hin1II CATG 4 cut(s) 239, 278, 1451, 1519
HincII GTYRAC 1 cut(s) 1763
HindII GTYRAC 1 cut(s) 1763
HindIII AAGCTT 7 cut(s) 179, 691, 753, 868, 1055, 1723, 2244
HphI GGTGA 7 cut(s) 518, 956, 1370, 1619, 1654, 2449, 2591
Hpy166II GTNNAC 3 cut(s) 737, 1763, 2333
Hpy8I GTNNAC 3 cut(s) 737, 1763, 2333
HpyCH4III ACNGT 8 cut(s) 110, 877, 1094, 1100, 1395, 1412, 2182, 2674
HpyCH4IV ACGT 2 cut(s) 733, 817
HpyF10VI GCNNNNNNNGC 2 cut(s) 280, 482
HpySE526I ACGT 2 cut(s) 733, 817
Hsp92II CATG 4 cut(s) 239, 278, 1451, 1519
Ksp22I TGATCA 1 cut(s) 120
LguI GCTCTTC 1 cut(s) 1518
LmnI GCTCC 3 cut(s) 288, 382, 1081
LweI GCATC 1 cut(s) 2738
MaeI CTAG 6 cut(s) 665, 708, 1713, 2051, 2219, 2751
MaeII ACGT 2 cut(s) 733, 817
MaeIII GTNAC 5 cut(s) 455, 1094, 1136, 2221, 2323
MfeI CAATTG 3 cut(s) 554, 915, 2226
MflI RGATCY 3 cut(s) 490, 672, 1374
MhlI GDGCHC 1 cut(s) 2586
MmeI TCCRAC 5 cut(s) 1203, 1377, 1685, 2059, 2632
MspA1I CMGCKG 3 cut(s) 118, 1974, 2008
MspCI CTTAAG 2 cut(s) 422, 1811
MssI GTTTAAAC 1 cut(s) 580
MunI CAATTG 3 cut(s) 554, 915, 2226
Mva1269I GAATGC 1 cut(s) 394
MwoI GCNNNNNNNGC 2 cut(s) 280, 482
NdeI CATATG 1 cut(s) 2265
NlaIII CATG 4 cut(s) 239, 278, 1451, 1519
NlaIV GGNNCC 1 cut(s) 1039
PaeR7I CTCGAG 1 cut(s) 1550
PciSI GCTCTTC 1 cut(s) 1518
PctI GAATGC 1 cut(s) 394
PflFI GACNNNGTC 1 cut(s) 29
PmeI GTTTAAAC 1 cut(s) 580
PpuMI RGGWCCY 1 cut(s) 1482
PsiI TTATAA 1 cut(s) 15
Psp124BI GAGCTC 1 cut(s) 2586
Psp1406I AACGTT 1 cut(s) 733
Psp5II RGGWCCY 1 cut(s) 1482
PspFI CCCAGC 1 cut(s) 1034
PspN4I GGNNCC 1 cut(s) 1039
PspPI GGNCC 5 cut(s) 418, 475, 1038, 1482, 2654
PspPPI RGGWCCY 1 cut(s) 1482
PspXI VCTCGAGB 1 cut(s) 1550
PsrI GAACNNNNNNTAC 2 cut(s) 913, 945
PstI CTGCAG 2 cut(s) 1014, 1878
PstNI CAGNNNCTG 1 cut(s) 1098
PsuI RGATCY 3 cut(s) 490, 672, 1374
PsyI GACNNNGTC 1 cut(s) 29
PvuII CAGCTG 3 cut(s) 118, 1974, 2008
RsaI GTAC 2 cut(s) 1788, 2388
RsaNI GTAC 2 cut(s) 1787, 2387
SacI GAGCTC 1 cut(s) 2586
SalI GTCGAC 1 cut(s) 1761
SapI GCTCTTC 1 cut(s) 1518
Sau96I GGNCC 5 cut(s) 418, 475, 1038, 1482, 2654
SduI GDGCHC 1 cut(s) 2586
SfaNI GCATC 1 cut(s) 2738
SfcI CTRYAG 4 cut(s) 441, 1010, 1874, 2276
Sfr274I CTCGAG 1 cut(s) 1550
SinI GGWCC 2 cut(s) 1482, 2654
SlaI CTCGAG 1 cut(s) 1550
SsiI CCGC 1 cut(s) 142
SspI AATATT 2 cut(s) 1464, 2542
SspMI CTAG 6 cut(s) 665, 708, 1713, 2051, 2219, 2751
SstI GAGCTC 1 cut(s) 2586
StyI CCWWGG 1 cut(s) 1485
TaaI ACNGT 8 cut(s) 110, 877, 1094, 1100, 1395, 1412, 2182, 2674
TaiI ACGT 2 cut(s) 736, 820
TaqI TCGA 4 cut(s) 1251, 1551, 1762, 2676
TatI WGTACW 1 cut(s) 1786
TscAI CASTG 4 cut(s) 115, 845, 2119, 2775
TspGWI ACGGA 1 cut(s) 1173
TspRI CASTG 4 cut(s) 115, 845, 2119, 2775
Tth111I GACNNNGTC 1 cut(s) 29
Vha464I CTTAAG 2 cut(s) 422, 1811
VpaK11BI GGWCC 2 cut(s) 1482, 2654
XapI RAATTY 9 cut(s) 81, 189, 711, 806, 950, 1108, 1301, 1731, 2561
XcmI CCANNNNNNNNNTGG 1 cut(s) 2437
XhoI CTCGAG 1 cut(s) 1550
XmiI GTMKAC 1 cut(s) 1762
XspI CTAG 6 cut(s) 665, 708, 1713, 2051, 2219, 2751
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.