RchiOBHm_Chr7g0205611

Sel1-like repeats.

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
23377041 .. 23384092
7052 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ18399

Sequence Viewer

Length: 189 bp
ATGAACTTGACTTCGAAAAGGGGTTCTTTAGCAAGAAAGGCAAGAACGAATGCAGAAAGCATTGTAAGAGACCAGGCAGGAATGGCAAGAGAGCGGTTTCAGATCACTGCAAAACCAGGATGTGATCTTGGACAGAAATGGTTGGAAAGACTTGACGAGGAAGAAAATTATCTATTGACCGAAGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

62

Amino Acids

7.11

Weight (kDa)

6.25

Isoelectric Point (pI)

35.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 94
AciI CCGC 1 cut(s) 94
AjnI CCWGG 2 cut(s) 72, 115
Alw26I GTCTC 1 cut(s) 63
AsuII TTCGAA 1 cut(s) 14
BciT130I CCWGG 2 cut(s) 74, 117
BcoDI GTCTC 1 cut(s) 63
Bme1390I CCNGG 2 cut(s) 74, 117
BmrFI CCNGG 2 cut(s) 74, 117
Bpu14I TTCGAA 1 cut(s) 14
BsaI GGTCTC 1 cut(s) 63
BseBI CCWGG 2 cut(s) 74, 117
BseGI GGATG 1 cut(s) 125
BsmAI GTCTC 1 cut(s) 63
BsmI GAATGC 1 cut(s) 55
Bso31I GGTCTC 1 cut(s) 63
Bsp119I TTCGAA 1 cut(s) 14
Bsp143I GATC 2 cut(s) 102, 124
BspACI CCGC 1 cut(s) 94
BspT104I TTCGAA 1 cut(s) 14
BspTNI GGTCTC 1 cut(s) 63
BsrBI CCGCTC 1 cut(s) 94
BssMI GATC 2 cut(s) 102, 124
Bst2UI CCWGG 2 cut(s) 74, 117
BstBI TTCGAA 1 cut(s) 14
BstF5I GGATG 1 cut(s) 125
BstKTI GATC 2 cut(s) 105, 127
BstMAI GTCTC 1 cut(s) 63
BstMBI GATC 2 cut(s) 102, 124
BstMWI GCNNNNNNNGC 2 cut(s) 38, 83
BstNI CCWGG 2 cut(s) 74, 117
BstSCI CCNGG 2 cut(s) 72, 115
BtsCI GGATG 1 cut(s) 125
BtsI GCAGTG 1 cut(s) 105
BtsIMutI CAGTG 1 cut(s) 105
DpnI GATC 2 cut(s) 104, 126
DpnII GATC 2 cut(s) 102, 124
Eco31I GGTCTC 1 cut(s) 63
EcoRII CCWGG 2 cut(s) 72, 115
FalI AAGNNNNNCTT 2 cut(s) 10, 42
FokI GGATG 1 cut(s) 132
Hpy188I TCNGA 1 cut(s) 102
HpyCH4V TGCA 2 cut(s) 53, 110
HpyF10VI GCNNNNNNNGC 2 cut(s) 38, 83
Kzo9I GATC 2 cut(s) 102, 124
LpnPI CCDG 5 cut(s) 59, 63, 86, 102, 129
MalI GATC 2 cut(s) 104, 126
MbiI CCGCTC 1 cut(s) 94
MboI GATC 2 cut(s) 102, 124
MboII GAAGA 1 cut(s) 173
MluCI AATT 1 cut(s) 166
MmeI TCCRAC 1 cut(s) 123
MnlI CCTC 1 cut(s) 151
MspR9I CCNGG 2 cut(s) 74, 117
Mva1269I GAATGC 1 cut(s) 55
MvaI CCWGG 2 cut(s) 74, 117
MwoI GCNNNNNNNGC 2 cut(s) 38, 83
NdeII GATC 2 cut(s) 102, 124
NspV TTCGAA 1 cut(s) 14
PctI GAATGC 1 cut(s) 55
Psp6I CCWGG 2 cut(s) 72, 115
PspGI CCWGG 2 cut(s) 72, 115
Sau3AI GATC 2 cut(s) 102, 124
ScrFI CCNGG 2 cut(s) 74, 117
SfuI TTCGAA 1 cut(s) 14
Sse9I AATT 1 cut(s) 166
SsiI CCGC 1 cut(s) 94
StyD4I CCNGG 2 cut(s) 72, 115
TaqI TCGA 1 cut(s) 14
TasI AATT 1 cut(s) 166
TscAI CASTG 1 cut(s) 112
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 112
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.