RLG00000033514

Sel1-like repeats.

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr7
OG0013755
Physical Location & Seq
Forward (+)
28315010 .. 28316729
1720 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000033514

Sequence Viewer

Length: 336 bp
ATGTCTGATTCCGAAACCGGGACGAAGATCGAGGATGATAGTGCCATGGCGGTGCCCTCCCAGAGTCGACGGGGTGTTGAAGTCCCAGAATCTTTGACGAACTGGACTTCAAAACGGGGGTTTTTCGCCACAAAGGCAAGAAAGATTGCAGAAAGCCTTGTGAGAGACCAGGCAGAAATGGCAAGAGAGCGGTTTCAGATCGCTACAAAAGCAGGATGTGATCTTGGACTGAGGTGGTTGGAAAGACTTGAACAGGAAGAGAAACATTTATTGCCCGGAAATAAATGGCAGAACATGCCCAAGGACGAAAGAAGGCCTGGTAATCGTTCAAGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Sel1

Protein Analysis

112

Amino Acids

12.73

Weight (kDa)

9.29

Isoelectric Point (pI)

79.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 52
AccBSI CCGCTC 1 cut(s) 190
AccI GTMKAC 1 cut(s) 67
AciI CCGC 2 cut(s) 50, 190
AfiI CCNNNNNNNGG 1 cut(s) 18
AgsI TTSAA 4 cut(s) 80, 111, 251, 330
AjnI CCWGG 2 cut(s) 168, 316
Alw26I GTCTC 1 cut(s) 159
AoxI GGCC 1 cut(s) 314
AsuC2I CCSGG 2 cut(s) 19, 276
BaeGI GKGCMC 1 cut(s) 57
BanI GGYRCC 1 cut(s) 52
BciT130I CCWGG 2 cut(s) 170, 318
BcnI CCSGG 2 cut(s) 19, 276
BcoDI GTCTC 1 cut(s) 159
BglI GCCNNNNNGGC 1 cut(s) 134
Bme1390I CCNGG 4 cut(s) 19, 170, 276, 318
BmiI GGNNCC 1 cut(s) 54
BmrFI CCNGG 4 cut(s) 19, 170, 276, 318
BpuMI CCSGG 2 cut(s) 19, 276
BsaI GGTCTC 1 cut(s) 159
BsaJI CCNNGG 2 cut(s) 45, 300
Bsc4I CCNNNNNNNGG 1 cut(s) 18
Bse1I ACTGG 1 cut(s) 107
BseBI CCWGG 2 cut(s) 170, 318
BseDI CCNNGG 2 cut(s) 45, 300
BseGI GGATG 2 cut(s) 40, 221
BseLI CCNNNNNNNGG 1 cut(s) 18
BseMII CTCAG 1 cut(s) 221
BseNI ACTGG 1 cut(s) 107
BseSI GKGCMC 1 cut(s) 57
BshFI GGCC 1 cut(s) 316
BshNI GGYRCC 1 cut(s) 52
BsiSI CCGG 2 cut(s) 18, 276
BslFI GGGAC 2 cut(s) 34, 68
BslI CCNNNNNNNGG 1 cut(s) 18
BsmAI GTCTC 1 cut(s) 159
BsmFI GGGAC 2 cut(s) 34, 68
BsnI GGCC 1 cut(s) 316
Bso31I GGTCTC 1 cut(s) 159
Bsp1286I GDGCHC 1 cut(s) 57
Bsp143I GATC 3 cut(s) 27, 198, 220
Bsp19I CCATGG 1 cut(s) 45
BspACI CCGC 2 cut(s) 50, 190
BspANI GGCC 1 cut(s) 316
BspCNI CTCAG 1 cut(s) 222
BspLI GGNNCC 1 cut(s) 54
BspT107I GGYRCC 1 cut(s) 52
BspTNI GGTCTC 1 cut(s) 159
BsrBI CCGCTC 1 cut(s) 190
BsrI ACTGG 1 cut(s) 107
BssECI CCNNGG 2 cut(s) 45, 300
BssMI GATC 3 cut(s) 27, 198, 220
BssT1I CCWWGG 2 cut(s) 45, 300
Bst2UI CCWGG 2 cut(s) 170, 318
Bst6I CTCTTC 1 cut(s) 252
BstAPI GCANNNNNTGC 1 cut(s) 295
BstDEI CTNAG 1 cut(s) 230
BstDSI CCRYGG 1 cut(s) 45
BstF5I GGATG 2 cut(s) 40, 221
BstKTI GATC 3 cut(s) 30, 201, 223
BstMAI GTCTC 1 cut(s) 159
BstMBI GATC 3 cut(s) 27, 198, 220
BstMWI GCNNNNNNNGC 4 cut(s) 134, 179, 209, 295
BstNI CCWGG 2 cut(s) 170, 318
BstNSI RCATGY 1 cut(s) 298
BstSCI CCNGG 4 cut(s) 17, 168, 274, 316
BstSLI GKGCMC 1 cut(s) 57
BsuRI GGCC 1 cut(s) 316
BtgI CCRYGG 1 cut(s) 45
BtsCI GGATG 2 cut(s) 40, 221
CviAII CATG 2 cut(s) 46, 295
CviJI RGCY 2 cut(s) 156, 316
CviKI_1 RGCY 2 cut(s) 156, 316
DdeI CTNAG 1 cut(s) 230
DpnI GATC 3 cut(s) 29, 200, 222
DpnII GATC 3 cut(s) 27, 198, 220
Eam1104I CTCTTC 1 cut(s) 252
EarI CTCTTC 1 cut(s) 252
Eco130I CCWWGG 2 cut(s) 45, 300
Eco147I AGGCCT 1 cut(s) 316
Eco31I GGTCTC 1 cut(s) 159
EcoRII CCWGG 2 cut(s) 168, 316
EcoT14I CCWWGG 2 cut(s) 45, 300
ErhI CCWWGG 2 cut(s) 45, 300
FaeI CATG 2 cut(s) 49, 298
FaiI YATR 2 cut(s) 47, 296
FaqI GGGAC 2 cut(s) 34, 68
FatI CATG 2 cut(s) 45, 294
FblI GTMKAC 1 cut(s) 67
FokI GGATG 2 cut(s) 47, 228
HaeIII GGCC 1 cut(s) 316
HapII CCGG 2 cut(s) 18, 276
Hin1II CATG 2 cut(s) 49, 298
HincII GTYRAC 1 cut(s) 68
HindII GTYRAC 1 cut(s) 68
HinfI GANTC 3 cut(s) 8, 64, 89
HpaII CCGG 2 cut(s) 18, 276
Hpy166II GTNNAC 1 cut(s) 68
Hpy188I TCNGA 3 cut(s) 7, 13, 198
Hpy188III TCNNGA 1 cut(s) 330
Hpy8I GTNNAC 1 cut(s) 68
Hpy99I CGWCG 1 cut(s) 72
HpyAV CCTTC 1 cut(s) 306
HpyCH4V TGCA 1 cut(s) 149
HpyF10VI GCNNNNNNNGC 4 cut(s) 134, 179, 209, 295
HpyF3I CTNAG 1 cut(s) 230
Hsp92II CATG 2 cut(s) 49, 298
Kzo9I GATC 3 cut(s) 27, 198, 220
MalI GATC 3 cut(s) 29, 200, 222
MbiI CCGCTC 1 cut(s) 190
MboI GATC 3 cut(s) 27, 198, 220
MboII GAAGA 2 cut(s) 37, 269
MhlI GDGCHC 1 cut(s) 57
MlyI GAGTC 1 cut(s) 73
MmeI TCCRAC 1 cut(s) 219
MnlI CCTC 3 cut(s) 25, 67, 225
MslI CAYNNNNRTG 1 cut(s) 50
MspI CCGG 2 cut(s) 18, 276
MspR9I CCNGG 4 cut(s) 19, 170, 276, 318
MvaI CCWGG 2 cut(s) 170, 318
MwoI GCNNNNNNNGC 4 cut(s) 134, 179, 209, 295
NciI CCSGG 2 cut(s) 19, 276
NcoI CCATGG 1 cut(s) 45
NdeII GATC 3 cut(s) 27, 198, 220
NlaIII CATG 2 cut(s) 49, 298
NlaIV GGNNCC 1 cut(s) 54
NspI RCATGY 1 cut(s) 298
PceI AGGCCT 1 cut(s) 316
PfeI GAWTC 2 cut(s) 8, 89
PleI GAGTC 1 cut(s) 72
PpsI GAGTC 1 cut(s) 72
Psp6I CCWGG 2 cut(s) 168, 316
PspGI CCWGG 2 cut(s) 168, 316
PspN4I GGNNCC 1 cut(s) 54
RseI CAYNNNNRTG 1 cut(s) 50
SalI GTCGAC 1 cut(s) 66
Sau3AI GATC 3 cut(s) 27, 198, 220
SchI GAGTC 1 cut(s) 73
ScrFI CCNGG 4 cut(s) 19, 170, 276, 318
SduI GDGCHC 1 cut(s) 57
SetI ASST 1 cut(s) 236
SmiMI CAYNNNNRTG 1 cut(s) 50
SseBI AGGCCT 1 cut(s) 316
SsiI CCGC 2 cut(s) 50, 190
StuI AGGCCT 1 cut(s) 316
StyD4I CCNGG 4 cut(s) 17, 168, 274, 316
StyI CCWWGG 2 cut(s) 45, 300
TaqI TCGA 2 cut(s) 30, 67
TfiI GAWTC 2 cut(s) 8, 89
XceI RCATGY 1 cut(s) 298
XmiI GTMKAC 1 cut(s) 67
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.