RchiOBHm_Chr7g0211801

isoform X1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0009689
Physical Location & Seq
Forward (+)
29003178 .. 29008187
5010 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ18948

Sequence Viewer

Length: 948 bp
ATGGGGAAGAAAGAAGGAGACTTGTGGGACGATTCGGCTCTCATCAATGCTTTCGACAACGCCATGACTACCTACAAGAAAATGCATAGCAAGAAACCCACTCAAGGTCCAACCCAGGAACACAAACTTGTGAGCAGTCCTGAAGAACAAGTCATTGTTGAGGCTGGTGAAACCCAGGAGGCTAAAAGAATACAAGGGGATGCAGATGACCCGACAAAAGATGAGAAGACTACTATGGAAATGGGAGAGACCAGTAATCTTTCAGAAGCTAAAGAAAATCATTGTTTAGATTCATATGTACCTGACCCCTATTCACAAGATGCTCAGGACATGCAAAACAACTATTCATATTCAGAAGGTGGAGAAGATTATACAAATTTACTCAACCAGTATTATGAGATTGAGGAGAAAAGACAGAAGATTCTAGAGAAACTTCATCAATTTGGTGGTGGGAATTACCAGTATTCTGGCGAAGGTTCAGGTTCAGGTTCTGGTGTACAGTGGGGTACTGTTTCTAGTTACGAACAAAATGCAGTCCCTGCTAGCCAACCTTCTGATCCAGCTGTTGTGGGTTCATGTTGCCCGTACATGTGTCCGTGCTTGATGACTGCATGCACTGCATTTCCTGCTTGTCCATTGGATTCGACATGTGCTGGTATAACTTGTACGGAAGCTTGTTTGGCAACAAGTAATGGGAAACCATTATCTCTTGAAGATAGAAAAATTGTCAAGACAGCATTTGGGACTGCAGAAAGAGCATTATCATCCATGAAAACAAATATTACTGTTGATTCTAGTAAAAGTGAAGAGAAAGATGAATCAGAAATGGCTGAAACTACTGGCTCAGAGACAGATATCAGTGTGGTACTGAATGCATGGTATTCCACAGGTTTCTACACTGGCAAGTATCTTGTGGAGCAATCCATTGCAAAGAAGCGACAAAGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
SMN

Protein Analysis

315

Amino Acids

34.41

Weight (kDa)

4.58

Isoelectric Point (pI)

54.1

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SMN_G2-BD PF20636 4 - 30 2e-13 Survival Motor Neuron, Gemin2-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 551
AcsI RAATTY 1 cut(s) 376
AcuI CTGAAG 1 cut(s) 162
AfaI GTAC 6 cut(s) 300, 498, 508, 587, 667, 867
AfiI CCNNNNNNNGG 1 cut(s) 104
AflIII ACRYGT 2 cut(s) 588, 647
AgsI TTSAA 1 cut(s) 713
AjnI CCWGG 2 cut(s) 114, 174
AluBI AGCT 3 cut(s) 269, 563, 674
AluI AGCT 3 cut(s) 269, 563, 674
Alw26I GTCTC 3 cut(s) 12, 242, 842
AlwI GGATC 1 cut(s) 551
AlwNI CAGNNNCTG 2 cut(s) 491, 539
ApoI RAATTY 1 cut(s) 376
AspS9I GGNCC 1 cut(s) 107
AsuHPI GGTGA 1 cut(s) 179
AsuNHI GCTAGC 1 cut(s) 542
AvaII GGWCC 1 cut(s) 107
BbsI GAAGAC 1 cut(s) 233
BcgI CGANNNNNNTGC 2 cut(s) 512, 546
BciT130I CCWGG 2 cut(s) 116, 176
BcoDI GTCTC 3 cut(s) 12, 242, 842
BfaI CTAG 4 cut(s) 425, 516, 543, 795
BfmI CTRYAG 1 cut(s) 747
Bme1390I CCNGG 2 cut(s) 116, 176
Bme18I GGWCC 1 cut(s) 107
BmgT120I GGNCC 1 cut(s) 107
BmrFI CCNGG 2 cut(s) 116, 176
BmsI GCATC 2 cut(s) 190, 310
BmtI GCTAGC 1 cut(s) 546
BpiI GAAGAC 1 cut(s) 233
Bpu10I CCTNAGC 1 cut(s) 324
BpuEI CTTGAG 1 cut(s) 87
BsaI GGTCTC 1 cut(s) 242
BsaJI CCNNGG 2 cut(s) 114, 174
Bsc4I CCNNNNNNNGG 1 cut(s) 104
Bse1I ACTGG 5 cut(s) 252, 388, 460, 844, 904
Bse3DI GCAATG 1 cut(s) 924
BseBI CCWGG 2 cut(s) 116, 176
BseDI CCNNGG 2 cut(s) 114, 174
BseGI GGATG 2 cut(s) 205, 764
BseLI CCNNNNNNNGG 1 cut(s) 104
BseMI GCAATG 1 cut(s) 924
BseMII CTCAG 2 cut(s) 338, 858
BseNI ACTGG 5 cut(s) 252, 388, 460, 844, 904
BseRI GAGGAG 1 cut(s) 419
BslFI GGGAC 3 cut(s) 41, 521, 757
BslI CCNNNNNNNGG 1 cut(s) 104
BsmAI GTCTC 3 cut(s) 12, 242, 842
BsmFI GGGAC 3 cut(s) 41, 521, 757
BsmI GAATGC 1 cut(s) 877
Bso31I GGTCTC 1 cut(s) 242
Bsp1407I TGTACA 1 cut(s) 496
Bsp143I GATC 1 cut(s) 556
BspCNI CTCAG 2 cut(s) 337, 857
BspMAI CTGCAG 1 cut(s) 751
BspOI GCTAGC 1 cut(s) 546
BspPI GGATC 1 cut(s) 551
BspTNI GGTCTC 1 cut(s) 242
BsrDI GCAATG 1 cut(s) 924
BsrGI TGTACA 1 cut(s) 496
BsrI ACTGG 5 cut(s) 252, 388, 460, 844, 904
BssECI CCNNGG 2 cut(s) 114, 174
BssMI GATC 1 cut(s) 556
Bst2UI CCWGG 2 cut(s) 116, 176
Bst4CI ACNGT 3 cut(s) 501, 511, 787
Bst6I CTCTTC 1 cut(s) 801
BstAPI GCANNNNNTGC 3 cut(s) 539, 617, 626
BstAUI TGTACA 1 cut(s) 496
BstC8I GCNNGC 2 cut(s) 544, 613
BstDEI CTNAG 2 cut(s) 324, 844
BstF5I GGATG 2 cut(s) 205, 764
BstKTI GATC 1 cut(s) 559
BstMAI GTCTC 3 cut(s) 12, 242, 842
BstMBI GATC 1 cut(s) 556
BstMWI GCNNNNNNNGC 5 cut(s) 539, 617, 626, 680, 755
BstNI CCWGG 2 cut(s) 116, 176
BstNSI RCATGY 4 cut(s) 334, 592, 615, 651
BstSCI CCNGG 2 cut(s) 114, 174
BstSFI CTRYAG 1 cut(s) 747
BstV2I GAAGAC 1 cut(s) 233
BstXI CCANNNNNNTGG 1 cut(s) 467
BtsCI GGATG 2 cut(s) 205, 764
BtsI GCAGTG 1 cut(s) 615
BtsIMutI CAGTG 4 cut(s) 506, 615, 865, 897
Cac8I GCNNGC 2 cut(s) 544, 613
CaiI CAGNNNCTG 2 cut(s) 491, 539
Cfr13I GGNCC 1 cut(s) 107
Csp6I GTAC 6 cut(s) 299, 497, 507, 586, 666, 866
CviAII CATG 8 cut(s) 64, 331, 576, 589, 612, 648, 769, 876
CviJI RGCY 9 cut(s) 38, 164, 182, 269, 546, 563, 674, 830, 843
CviKI_1 RGCY 9 cut(s) 38, 164, 182, 269, 546, 563, 674, 830, 843
CviQI GTAC 6 cut(s) 299, 497, 507, 586, 666, 866
DdeI CTNAG 2 cut(s) 324, 844
DpnI GATC 1 cut(s) 558
DpnII GATC 1 cut(s) 556
Eam1104I CTCTTC 1 cut(s) 801
EarI CTCTTC 1 cut(s) 801
Eco31I GGTCTC 1 cut(s) 242
Eco32I GATATC 1 cut(s) 856
Eco47I GGWCC 1 cut(s) 107
Eco57I CTGAAG 1 cut(s) 162
EcoRII CCWGG 2 cut(s) 114, 174
EcoRV GATATC 1 cut(s) 856
EcoT22I ATGCAT 2 cut(s) 87, 877
FaeI CATG 8 cut(s) 67, 334, 579, 592, 615, 651, 772, 879
FaqI GGGAC 3 cut(s) 41, 521, 757
FatI CATG 8 cut(s) 63, 330, 575, 588, 611, 647, 768, 875
FauNDI CATATG 1 cut(s) 295
FokI GGATG 2 cut(s) 212, 751
FspBI CTAG 4 cut(s) 425, 516, 543, 795
Hin1II CATG 8 cut(s) 67, 334, 579, 592, 615, 651, 772, 879
HindIII AAGCTT 1 cut(s) 672
HinfI GANTC 6 cut(s) 32, 290, 421, 641, 791, 818
HphI GGTGA 1 cut(s) 179
Hpy166II GTNNAC 1 cut(s) 497
Hpy188I TCNGA 5 cut(s) 265, 355, 556, 823, 847
Hpy188III TCNNGA 5 cut(s) 140, 326, 425, 710, 730
Hpy8I GTNNAC 1 cut(s) 497
HpyAV CCTTC 4 cut(s) 8, 350, 467, 561
HpyCH4III ACNGT 3 cut(s) 501, 511, 787
HpyF10VI GCNNNNNNNGC 5 cut(s) 539, 617, 626, 680, 755
HpyF3I CTNAG 2 cut(s) 324, 844
Hsp92II CATG 8 cut(s) 67, 334, 579, 592, 615, 651, 772, 879
Kzo9I GATC 1 cut(s) 556
LmnI GCTCC 1 cut(s) 916
LweI GCATC 2 cut(s) 190, 310
MaeI CTAG 4 cut(s) 425, 516, 543, 795
MaeIII GTNAC 1 cut(s) 518
MalI GATC 1 cut(s) 558
MboI GATC 1 cut(s) 556
MboII GAAGA 7 cut(s) 19, 155, 238, 377, 430, 725, 818
MluCI AATT 4 cut(s) 376, 440, 454, 723
MmeI TCCRAC 1 cut(s) 134
MnlI CCTC 3 cut(s) 154, 172, 397
Mph1103I ATGCAT 2 cut(s) 87, 877
MseI TTAA 1 cut(s) 946
MspA1I CMGCKG 1 cut(s) 563
MspR9I CCNGG 2 cut(s) 116, 176
Mva1269I GAATGC 1 cut(s) 877
MvaI CCWGG 2 cut(s) 116, 176
MwoI GCNNNNNNNGC 5 cut(s) 539, 617, 626, 680, 755
NdeI CATATG 1 cut(s) 295
NdeII GATC 1 cut(s) 556
NheI GCTAGC 1 cut(s) 542
NlaIII CATG 8 cut(s) 67, 334, 579, 592, 615, 651, 772, 879
NsiI ATGCAT 2 cut(s) 87, 877
NspI RCATGY 4 cut(s) 334, 592, 615, 651
PaeI GCATGC 1 cut(s) 615
PciI ACATGT 2 cut(s) 588, 647
PctI GAATGC 1 cut(s) 877
PfeI GAWTC 6 cut(s) 32, 290, 421, 641, 791, 818
PscI ACATGT 2 cut(s) 588, 647
Psp6I CCWGG 2 cut(s) 114, 174
PspGI CCWGG 2 cut(s) 114, 174
PspPI GGNCC 1 cut(s) 107
PstI CTGCAG 1 cut(s) 751
PstNI CAGNNNCTG 2 cut(s) 491, 539
PvuII CAGCTG 1 cut(s) 563
RsaI GTAC 6 cut(s) 300, 498, 508, 587, 667, 867
RsaNI GTAC 6 cut(s) 299, 497, 507, 586, 666, 866
SaqAI TTAA 1 cut(s) 946
Sau3AI GATC 1 cut(s) 556
Sau96I GGNCC 1 cut(s) 107
ScrFI CCNGG 2 cut(s) 116, 176
SfaNI GCATC 2 cut(s) 190, 310
SfcI CTRYAG 1 cut(s) 747
SinI GGWCC 1 cut(s) 107
SmlI CTYRAG 1 cut(s) 102
SmoI CTYRAG 1 cut(s) 102
SphI GCATGC 1 cut(s) 615
Sse9I AATT 4 cut(s) 376, 440, 454, 723
SspI AATATT 1 cut(s) 781
SspMI CTAG 4 cut(s) 425, 516, 543, 795
StyD4I CCNGG 2 cut(s) 114, 174
TaaI ACNGT 3 cut(s) 501, 511, 787
TaqI TCGA 2 cut(s) 54, 644
TasI AATT 4 cut(s) 376, 440, 454, 723
TatI WGTACW 1 cut(s) 496
TfiI GAWTC 6 cut(s) 32, 290, 421, 641, 791, 818
Tru1I TTAA 1 cut(s) 946
Tru9I TTAA 1 cut(s) 946
TscAI CASTG 4 cut(s) 506, 622, 865, 904
TspDTI ATGAA 6 cut(s) 282, 336, 425, 564, 785, 831
TspGWI ACGGA 2 cut(s) 585, 683
TspRI CASTG 4 cut(s) 506, 622, 865, 904
VpaK11BI GGWCC 1 cut(s) 107
XapI RAATTY 1 cut(s) 376
XbaI TCTAGA 1 cut(s) 424
XceI RCATGY 4 cut(s) 334, 592, 615, 651
XspI CTAG 4 cut(s) 425, 516, 543, 795
Zsp2I ATGCAT 2 cut(s) 87, 877
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.