RchiOBHm_Chr7g0213171

21 kDa protein-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0013765
Physical Location & Seq
Reverse (-)
30310368 .. 30311179
812 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ19080

Sequence Viewer

Length: 612 bp
ATGGAAGGCTATCTTGTACGTACACTTTTAGCTTTCGCCATTCTCTCATTGTTTAACCACATAAACCCCTGCACAGCAACCTTGCTTCCTAATGAACCAAACACCGATTTCATAAGAACCTCTTGCAAAGTCACATTACATCCCATTTTGTGCTATAATTCTCTCAAGGATTACGCATGCAAAATCCAGACTGATCCGAAATTGCTAGCTTATACTGCTGTCAATGTGACTCTTGAGTTCACCAAACAATCTCTAGCGACAGTGAAGCGGTTTCAAGAGATTGGTGGTTTGAATCCTGTTTTAGCTTCAACAATGGAGGCATGTGCAAATGAACTTACTGTCGCTATGGACGACATCCAGAATTCCAAAGAGGGATTGGAGGATCATGTAACAGAAGGCTCTGAGCCCAAGCTTGACATGGGTAATACTCAGGCGTGGCTTAATGCCGGACTAGCAATAGAGCAGAAATGCTTTGATAGCTTTGCTGTAGATCATCTTGACGGGAAAGTGGAGACCCTTACTCGCAGAAATATTATGATAGTCGCGCATTTAACAAGCAATGCCGTGCAACTCCTCAACCACTATGCATTATCTAAATTTACATATCCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PMEI

Protein Analysis

203

Amino Acids

22.52

Weight (kDa)

5.47

Isoelectric Point (pI)

42.08

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PMEI PF04043 36 - 190 2.4e-19 Plant invertase/pectin methylesterase inhibitor
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 545
AciI CCGC 1 cut(s) 268
AclWI GGATC 2 cut(s) 188, 390
AcsI RAATTY 2 cut(s) 361, 596
AfaI GTAC 2 cut(s) 18, 22
AgsI TTSAA 3 cut(s) 275, 292, 309
AluBI AGCT 5 cut(s) 32, 209, 305, 412, 480
AluI AGCT 5 cut(s) 32, 209, 305, 412, 480
Alw26I GTCTC 1 cut(s) 506
AlwI GGATC 2 cut(s) 188, 390
ApoI RAATTY 2 cut(s) 361, 596
AspLEI GCGC 1 cut(s) 547
AsuHPI GGTGA 1 cut(s) 232
AsuNHI GCTAGC 1 cut(s) 205
BanII GRGCYC 1 cut(s) 408
BceAI ACGGC 1 cut(s) 548
BcoDI GTCTC 1 cut(s) 506
BfaI CTAG 3 cut(s) 206, 254, 452
BfmI CTRYAG 1 cut(s) 486
BmtI GCTAGC 1 cut(s) 209
BpuEI CTTGAG 2 cut(s) 149, 254
BsaAI YACGTR 1 cut(s) 20
BsaI GGTCTC 1 cut(s) 506
Bse3DI GCAATG 1 cut(s) 565
BseGI GGATG 2 cut(s) 139, 354
BseMI GCAATG 1 cut(s) 565
BseMII CTCAG 2 cut(s) 393, 443
BseRI GAGGAG 1 cut(s) 563
BsgI GTGCAG 1 cut(s) 55
Bsh1236I CGCG 1 cut(s) 545
BsiSI CCGG 1 cut(s) 447
BsmAI GTCTC 1 cut(s) 506
Bso31I GGTCTC 1 cut(s) 506
Bsp1286I GDGCHC 1 cut(s) 408
Bsp143I GATC 3 cut(s) 193, 382, 490
BspACI CCGC 1 cut(s) 268
BspCNI CTCAG 2 cut(s) 394, 442
BspFNI CGCG 1 cut(s) 545
BspOI GCTAGC 1 cut(s) 209
BspPI GGATC 2 cut(s) 188, 390
BspTNI GGTCTC 1 cut(s) 506
BsrDI GCAATG 1 cut(s) 565
BssMI GATC 3 cut(s) 193, 382, 490
Bst4CI ACNGT 2 cut(s) 262, 340
BstBAI YACGTR 1 cut(s) 20
BstC8I GCNNGC 2 cut(s) 178, 207
BstDEI CTNAG 3 cut(s) 402, 429, 609
BstF5I GGATG 2 cut(s) 139, 354
BstFNI CGCG 1 cut(s) 545
BstHHI GCGC 1 cut(s) 547
BstKTI GATC 3 cut(s) 196, 385, 493
BstMAI GTCTC 1 cut(s) 506
BstMBI GATC 3 cut(s) 193, 382, 490
BstMWI GCNNNNNNNGC 3 cut(s) 215, 452, 477
BstNSI RCATGY 2 cut(s) 180, 324
BstSFI CTRYAG 1 cut(s) 486
BstSNI TACGTA 1 cut(s) 20
BstUI CGCG 1 cut(s) 545
BtsCI GGATG 2 cut(s) 139, 354
BtsIMutI CAGTG 1 cut(s) 267
Cac8I GCNNGC 2 cut(s) 178, 207
CfoI GCGC 1 cut(s) 547
Csp6I GTAC 2 cut(s) 17, 21
CviAII CATG 4 cut(s) 177, 321, 386, 418
CviJI RGCY 9 cut(s) 9, 32, 209, 305, 399, 406, 412, 439, 480
CviKI_1 RGCY 9 cut(s) 9, 32, 209, 305, 399, 406, 412, 439, 480
CviQI GTAC 2 cut(s) 17, 21
DdeI CTNAG 3 cut(s) 402, 429, 609
DpnI GATC 3 cut(s) 195, 384, 492
DpnII GATC 3 cut(s) 193, 382, 490
Eco105I TACGTA 1 cut(s) 20
Eco24I GRGCYC 1 cut(s) 408
Eco31I GGTCTC 1 cut(s) 506
EcoRI GAATTC 1 cut(s) 361
EcoT22I ATGCAT 1 cut(s) 589
EcoT38I GRGCYC 1 cut(s) 408
FaeI CATG 4 cut(s) 180, 324, 389, 421
FalI AAGNNNNNCTT 3 cut(s) 29, 106, 138
FatI CATG 4 cut(s) 176, 320, 385, 417
FokI GGATG 2 cut(s) 126, 341
FriOI GRGCYC 1 cut(s) 408
FspBI CTAG 3 cut(s) 206, 254, 452
GlaI GCGC 1 cut(s) 546
HapII CCGG 1 cut(s) 447
HhaI GCGC 1 cut(s) 547
Hin1II CATG 4 cut(s) 180, 324, 389, 421
Hin6I GCGC 1 cut(s) 545
HinP1I GCGC 1 cut(s) 545
HindIII AAGCTT 1 cut(s) 410
HinfI GANTC 2 cut(s) 229, 292
HpaII CCGG 1 cut(s) 447
HphI GGTGA 1 cut(s) 232
Hpy166II GTNNAC 2 cut(s) 23, 240
Hpy188I TCNGA 2 cut(s) 198, 403
Hpy188III TCNNGA 5 cut(s) 187, 233, 275, 358, 497
Hpy8I GTNNAC 2 cut(s) 23, 240
HpyAV CCTTC 1 cut(s) 389
HpyCH4III ACNGT 2 cut(s) 262, 340
HpyCH4IV ACGT 1 cut(s) 19
HpyCH4V TGCA 6 cut(s) 72, 126, 180, 326, 568, 587
HpyF10VI GCNNNNNNNGC 3 cut(s) 215, 452, 477
HpyF3I CTNAG 3 cut(s) 402, 429, 609
HpySE526I ACGT 1 cut(s) 19
Hsp92II CATG 4 cut(s) 180, 324, 389, 421
HspAI GCGC 1 cut(s) 545
Kzo9I GATC 3 cut(s) 193, 382, 490
LpnPI CCDG 6 cut(s) 82, 200, 309, 371, 416, 460
MaeI CTAG 3 cut(s) 206, 254, 452
MaeII ACGT 1 cut(s) 19
MaeIII GTNAC 3 cut(s) 130, 226, 388
MalI GATC 3 cut(s) 195, 384, 492
MboI GATC 3 cut(s) 193, 382, 490
MhlI GDGCHC 1 cut(s) 408
MluCI AATT 4 cut(s) 157, 200, 361, 596
MlyI GAGTC 1 cut(s) 223
MnlI CCTC 5 cut(s) 130, 310, 364, 373, 584
Mph1103I ATGCAT 1 cut(s) 589
MseI TTAA 3 cut(s) 54, 441, 551
MspI CCGG 1 cut(s) 447
MvnI CGCG 1 cut(s) 545
MwoI GCNNNNNNNGC 3 cut(s) 215, 452, 477
NdeII GATC 3 cut(s) 193, 382, 490
NheI GCTAGC 1 cut(s) 205
NlaIII CATG 4 cut(s) 180, 324, 389, 421
NmuCI GTSAC 2 cut(s) 130, 226
NsiI ATGCAT 1 cut(s) 589
NspI RCATGY 2 cut(s) 180, 324
PaeI GCATGC 1 cut(s) 180
PcsI WCGNNNNNNNCGW 1 cut(s) 348
PfeI GAWTC 1 cut(s) 292
PleI GAGTC 1 cut(s) 223
PpsI GAGTC 1 cut(s) 223
Ppu21I YACGTR 1 cut(s) 20
RsaI GTAC 2 cut(s) 18, 22
RsaNI GTAC 2 cut(s) 17, 21
SaqAI TTAA 3 cut(s) 54, 441, 551
Sau3AI GATC 3 cut(s) 193, 382, 490
SchI GAGTC 1 cut(s) 223
SduI GDGCHC 1 cut(s) 408
SetI ASST 8 cut(s) 22, 34, 83, 122, 211, 307, 414, 482
SfcI CTRYAG 1 cut(s) 486
SmlI CTYRAG 2 cut(s) 164, 233
SmoI CTYRAG 2 cut(s) 164, 233
SnaBI TACGTA 1 cut(s) 20
SphI GCATGC 1 cut(s) 180
Sse9I AATT 4 cut(s) 157, 200, 361, 596
SsiI CCGC 1 cut(s) 268
SspI AATATT 1 cut(s) 532
SspMI CTAG 3 cut(s) 206, 254, 452
TaaI ACNGT 2 cut(s) 262, 340
TaiI ACGT 1 cut(s) 22
TasI AATT 4 cut(s) 157, 200, 361, 596
TfiI GAWTC 1 cut(s) 292
Tru1I TTAA 3 cut(s) 54, 441, 551
Tru9I TTAA 3 cut(s) 54, 441, 551
TscAI CASTG 1 cut(s) 267
TseFI GTSAC 2 cut(s) 130, 226
Tsp45I GTSAC 2 cut(s) 130, 226
TspDTI ATGAA 3 cut(s) 100, 108, 345
TspRI CASTG 1 cut(s) 267
XapI RAATTY 2 cut(s) 361, 596
XceI RCATGY 2 cut(s) 180, 324
XcmI CCANNNNNNNNNTGG 2 cut(s) 373, 415
XspI CTAG 3 cut(s) 206, 254, 452
Zsp2I ATGCAT 1 cut(s) 589
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.