Rh7DG279700

21 kDa protein-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
OG0013765
Physical Location & Seq
Reverse (-)
30204883 .. 30205491
609 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG279700.1

Sequence Viewer

Length: 609 bp
ATGGAAGGCTATACAAGTACACTTTTAGCTTTCGCCATTCTCTCATTGTTTAACCACATAAACCCCTGCACAGCAACCTTGCTTCCTAATGAACCAAACACCGACTTCATAAGAACCTCTTGCAAAGTCACATTACATCCCATTTTGTGCTATAATTCTCTCAAGGATTACGCATGCAAAATCCAGACTGATCCGAAATTGCTAGCTTATACTGCTGTCAATGTGACTCTTGAGTTCACCAAACAATCTCTAGCGACAGTGAAGCGGTTTCAAGAGATTGGTGGTTTGAATCCTGTTTTAGCTTCAACAATGGAGGCATGTGCAAATGAACTTACTGTCGCTATGGACGACATCCAGAATTCCAAAGAGGGATTGGAGGATCATGTAACAGAAGGCTCTGATCCCAAGCTTGAAATGGGTAATACTCAGGCGTGGCTTAATGCCGGACTAACAATAGAGCAGAAATGCTTTGATGGCTTTGCTGTAGATCATCTTGATGGGAAAGTGGAGACCCTTACTCGCAGAAATATTATGAAAGTCGCGCATTTAACAAGCAATGCCGTGCAACTCCTCAACCACTATGCATTATCTAAAGTTACATATCCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PMEI

Protein Analysis

202

Amino Acids

22.31

Weight (kDa)

5.47

Isoelectric Point (pI)

38.12

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PMEI PF04043 35 - 189 3e-21 Plant invertase/pectin methylesterase inhibitor
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 542
AciI CCGC 1 cut(s) 265
AclWI GGATC 3 cut(s) 185, 387, 395
AcsI RAATTY 1 cut(s) 358
AfaI GTAC 1 cut(s) 19
AgsI TTSAA 4 cut(s) 272, 289, 306, 413
AluBI AGCT 4 cut(s) 29, 206, 302, 409
AluI AGCT 4 cut(s) 29, 206, 302, 409
Alw26I GTCTC 1 cut(s) 503
AlwI GGATC 3 cut(s) 185, 387, 395
ApoI RAATTY 1 cut(s) 358
AspLEI GCGC 1 cut(s) 544
AsuHPI GGTGA 1 cut(s) 229
AsuNHI GCTAGC 1 cut(s) 202
BccI CCATC 2 cut(s) 467, 491
BceAI ACGGC 1 cut(s) 545
BcoDI GTCTC 1 cut(s) 503
BfaI CTAG 2 cut(s) 203, 251
BfmI CTRYAG 1 cut(s) 483
BmtI GCTAGC 1 cut(s) 206
BpuEI CTTGAG 2 cut(s) 146, 251
BsaI GGTCTC 1 cut(s) 503
Bse3DI GCAATG 1 cut(s) 562
BseGI GGATG 2 cut(s) 136, 351
BseMI GCAATG 1 cut(s) 562
BseMII CTCAG 1 cut(s) 440
BseRI GAGGAG 1 cut(s) 560
BsgI GTGCAG 1 cut(s) 52
Bsh1236I CGCG 1 cut(s) 542
BsiSI CCGG 1 cut(s) 444
BsmAI GTCTC 1 cut(s) 503
Bso31I GGTCTC 1 cut(s) 503
Bsp143I GATC 4 cut(s) 190, 379, 400, 487
BspACI CCGC 1 cut(s) 265
BspCNI CTCAG 1 cut(s) 439
BspFNI CGCG 1 cut(s) 542
BspOI GCTAGC 1 cut(s) 206
BspPI GGATC 3 cut(s) 185, 387, 395
BspTNI GGTCTC 1 cut(s) 503
BsrDI GCAATG 1 cut(s) 562
BssMI GATC 4 cut(s) 190, 379, 400, 487
Bst4CI ACNGT 2 cut(s) 259, 337
BstC8I GCNNGC 2 cut(s) 175, 204
BstDEI CTNAG 1 cut(s) 426
BstF5I GGATG 2 cut(s) 136, 351
BstFNI CGCG 1 cut(s) 542
BstHHI GCGC 1 cut(s) 544
BstKTI GATC 4 cut(s) 193, 382, 403, 490
BstMAI GTCTC 1 cut(s) 503
BstMBI GATC 4 cut(s) 190, 379, 400, 487
BstMWI GCNNNNNNNGC 2 cut(s) 212, 474
BstNSI RCATGY 2 cut(s) 177, 321
BstSFI CTRYAG 1 cut(s) 483
BstUI CGCG 1 cut(s) 542
BtsCI GGATG 2 cut(s) 136, 351
BtsIMutI CAGTG 1 cut(s) 264
Cac8I GCNNGC 2 cut(s) 175, 204
CfoI GCGC 1 cut(s) 544
Csp6I GTAC 1 cut(s) 18
CviAII CATG 3 cut(s) 174, 318, 383
CviJI RGCY 8 cut(s) 9, 29, 206, 302, 396, 409, 436, 477
CviKI_1 RGCY 8 cut(s) 9, 29, 206, 302, 396, 409, 436, 477
CviQI GTAC 1 cut(s) 18
DdeI CTNAG 1 cut(s) 426
DpnI GATC 4 cut(s) 192, 381, 402, 489
DpnII GATC 4 cut(s) 190, 379, 400, 487
Eco31I GGTCTC 1 cut(s) 503
EcoRI GAATTC 1 cut(s) 358
EcoT22I ATGCAT 1 cut(s) 586
FaeI CATG 3 cut(s) 177, 321, 386
FalI AAGNNNNNCTT 2 cut(s) 103, 135
FatI CATG 3 cut(s) 173, 317, 382
FokI GGATG 2 cut(s) 123, 338
FspBI CTAG 2 cut(s) 203, 251
GlaI GCGC 1 cut(s) 543
HapII CCGG 1 cut(s) 444
HhaI GCGC 1 cut(s) 544
Hin1II CATG 3 cut(s) 177, 321, 386
Hin6I GCGC 1 cut(s) 542
HinP1I GCGC 1 cut(s) 542
HindIII AAGCTT 1 cut(s) 407
HinfI GANTC 2 cut(s) 226, 289
HpaII CCGG 1 cut(s) 444
HphI GGTGA 1 cut(s) 229
Hpy166II GTNNAC 2 cut(s) 20, 237
Hpy188I TCNGA 2 cut(s) 195, 400
Hpy188III TCNNGA 5 cut(s) 184, 230, 272, 355, 494
Hpy8I GTNNAC 2 cut(s) 20, 237
HpyAV CCTTC 1 cut(s) 386
HpyCH4III ACNGT 2 cut(s) 259, 337
HpyCH4V TGCA 6 cut(s) 69, 123, 177, 323, 565, 584
HpyF10VI GCNNNNNNNGC 2 cut(s) 212, 474
HpyF3I CTNAG 1 cut(s) 426
Hsp92II CATG 3 cut(s) 177, 321, 386
HspAI GCGC 1 cut(s) 542
Kzo9I GATC 4 cut(s) 190, 379, 400, 487
LpnPI CCDG 6 cut(s) 79, 197, 306, 368, 413, 457
MaeI CTAG 2 cut(s) 203, 251
MaeIII GTNAC 4 cut(s) 127, 223, 385, 595
MalI GATC 4 cut(s) 192, 381, 402, 489
MboI GATC 4 cut(s) 190, 379, 400, 487
MluCI AATT 3 cut(s) 154, 197, 358
MlyI GAGTC 1 cut(s) 220
MnlI CCTC 5 cut(s) 127, 307, 361, 370, 581
Mph1103I ATGCAT 1 cut(s) 586
MseI TTAA 3 cut(s) 51, 438, 548
MslI CAYNNNNRTG 1 cut(s) 495
MspI CCGG 1 cut(s) 444
MvnI CGCG 1 cut(s) 542
MwoI GCNNNNNNNGC 2 cut(s) 212, 474
NdeII GATC 4 cut(s) 190, 379, 400, 487
NheI GCTAGC 1 cut(s) 202
NlaIII CATG 3 cut(s) 177, 321, 386
NmuCI GTSAC 2 cut(s) 127, 223
NsiI ATGCAT 1 cut(s) 586
NspI RCATGY 2 cut(s) 177, 321
PaeI GCATGC 1 cut(s) 177
PcsI WCGNNNNNNNCGW 1 cut(s) 345
PfeI GAWTC 1 cut(s) 289
PleI GAGTC 1 cut(s) 220
PpsI GAGTC 1 cut(s) 220
RsaI GTAC 1 cut(s) 19
RsaNI GTAC 1 cut(s) 18
RseI CAYNNNNRTG 1 cut(s) 495
SaqAI TTAA 3 cut(s) 51, 438, 548
Sau3AI GATC 4 cut(s) 190, 379, 400, 487
SchI GAGTC 1 cut(s) 220
SetI ASST 6 cut(s) 31, 80, 119, 208, 304, 411
SfcI CTRYAG 1 cut(s) 483
SmiMI CAYNNNNRTG 1 cut(s) 495
SmlI CTYRAG 2 cut(s) 161, 230
SmoI CTYRAG 2 cut(s) 161, 230
SphI GCATGC 1 cut(s) 177
Sse9I AATT 3 cut(s) 154, 197, 358
SsiI CCGC 1 cut(s) 265
SspI AATATT 1 cut(s) 529
SspMI CTAG 2 cut(s) 203, 251
TaaI ACNGT 2 cut(s) 259, 337
TasI AATT 3 cut(s) 154, 197, 358
TatI WGTACW 1 cut(s) 17
TfiI GAWTC 1 cut(s) 289
Tru1I TTAA 3 cut(s) 51, 438, 548
Tru9I TTAA 3 cut(s) 51, 438, 548
TscAI CASTG 1 cut(s) 264
TseFI GTSAC 2 cut(s) 127, 223
Tsp45I GTSAC 2 cut(s) 127, 223
TspDTI ATGAA 4 cut(s) 97, 105, 342, 548
TspRI CASTG 1 cut(s) 264
XapI RAATTY 1 cut(s) 358
XceI RCATGY 2 cut(s) 177, 321
XcmI CCANNNNNNNNNTGG 2 cut(s) 370, 412
XspI CTAG 2 cut(s) 203, 251
Zsp2I ATGCAT 1 cut(s) 586
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.