RchiOBHm_Chr7g0231661

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
55319859 .. 55323403
3545 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ20762

Sequence Viewer

Length: 228 bp
ATGCTTACTTTTGTGACCTCAGTTAGTAGCCAGGGTTCTGTTATTTCTAATGGTAGAAAAGGCTCAGCTGACAGAAATTTCAATAATGAAAGGGGGTGGAAGGCCCAGAGTGAGTTGGATATGTGCGCCAAGGGATTAGAGATGAATAACCTGAGTAGGCTGATGGGTTCGGAGGCTGTAAATTACACTTGTGTGGAGTGGAGGAGTTGTATGAGAAGATGCTTGTGA

Protein Analysis

75

Amino Acids

8.41

Weight (kDa)

8.88

Isoelectric Point (pI)

42.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 76
AgsI TTSAA 1 cut(s) 82
AjnI CCWGG 1 cut(s) 30
AleI CACNNNNGTG 1 cut(s) 191
AluBI AGCT 1 cut(s) 68
AluI AGCT 1 cut(s) 68
AoxI GGCC 1 cut(s) 102
ApoI RAATTY 1 cut(s) 76
AspLEI GCGC 1 cut(s) 128
AspS9I GGNCC 1 cut(s) 103
BccI CCATC 1 cut(s) 157
BciT130I CCWGG 1 cut(s) 32
BlpI GCTNAGC 1 cut(s) 64
Bme1390I CCNGG 1 cut(s) 32
BmgT120I GGNCC 1 cut(s) 103
BmrFI CCNGG 1 cut(s) 32
BmsI GCATC 1 cut(s) 209
Bpu1102I GCTNAGC 1 cut(s) 64
BsaJI CCNNGG 2 cut(s) 31, 129
BsaXI ACNNNNNCTCC 2 cut(s) 193, 223
BseBI CCWGG 1 cut(s) 32
BseDI CCNNGG 2 cut(s) 31, 129
BseMII CTCAG 3 cut(s) 33, 78, 143
BseRI GAGGAG 1 cut(s) 217
BshFI GGCC 1 cut(s) 104
BsnI GGCC 1 cut(s) 104
Bsp1720I GCTNAGC 1 cut(s) 64
BspANI GGCC 1 cut(s) 104
BspCNI CTCAG 3 cut(s) 32, 77, 144
BssECI CCNNGG 2 cut(s) 31, 129
BssT1I CCWWGG 1 cut(s) 129
Bst2UI CCWGG 1 cut(s) 32
BstDEI CTNAG 3 cut(s) 19, 64, 152
BstHHI GCGC 1 cut(s) 128
BstNI CCWGG 1 cut(s) 32
BstSCI CCNGG 1 cut(s) 30
BsuRI GGCC 1 cut(s) 104
CfoI GCGC 1 cut(s) 128
Cfr13I GGNCC 1 cut(s) 103
CviJI RGCY 6 cut(s) 30, 63, 68, 104, 160, 176
CviKI_1 RGCY 6 cut(s) 30, 63, 68, 104, 160, 176
DdeI CTNAG 3 cut(s) 19, 64, 152
Eco130I CCWWGG 1 cut(s) 129
EcoRII CCWGG 1 cut(s) 30
EcoT14I CCWWGG 1 cut(s) 129
ErhI CCWWGG 1 cut(s) 129
FaiI YATR 2 cut(s) 122, 212
GlaI GCGC 1 cut(s) 127
HaeIII GGCC 1 cut(s) 104
HhaI GCGC 1 cut(s) 128
Hin6I GCGC 1 cut(s) 126
HinP1I GCGC 1 cut(s) 126
Hpy188I TCNGA 1 cut(s) 172
HpyAV CCTTC 1 cut(s) 94
HpyF3I CTNAG 3 cut(s) 19, 64, 152
HspAI GCGC 1 cut(s) 126
LpnPI CCDG 4 cut(s) 17, 44, 119, 164
LweI GCATC 1 cut(s) 209
MaeIII GTNAC 1 cut(s) 13
MboII GAAGA 1 cut(s) 228
MluCI AATT 2 cut(s) 76, 181
MmeI TCCRAC 1 cut(s) 96
MnlI CCTC 3 cut(s) 28, 166, 195
MslI CAYNNNNRTG 1 cut(s) 191
MspA1I CMGCKG 1 cut(s) 68
MspR9I CCNGG 1 cut(s) 32
MvaI CCWGG 1 cut(s) 32
NmuCI GTSAC 1 cut(s) 13
OliI CACNNNNGTG 1 cut(s) 191
Psp6I CCWGG 1 cut(s) 30
PspGI CCWGG 1 cut(s) 30
PspPI GGNCC 1 cut(s) 103
PsrI GAACNNNNNNTAC 2 cut(s) 19, 51
PvuII CAGCTG 1 cut(s) 68
RseI CAYNNNNRTG 1 cut(s) 191
Sau96I GGNCC 1 cut(s) 103
ScrFI CCNGG 1 cut(s) 32
SetI ASST 3 cut(s) 20, 70, 153
SfaNI GCATC 1 cut(s) 209
SgeI CNNG 6 cut(s) 43, 44, 118, 142, 163, 201
SmiMI CAYNNNNRTG 1 cut(s) 191
Sse9I AATT 2 cut(s) 76, 181
StyD4I CCNGG 1 cut(s) 30
StyI CCWWGG 1 cut(s) 129
TasI AATT 2 cut(s) 76, 181
TseFI GTSAC 1 cut(s) 13
Tsp45I GTSAC 1 cut(s) 13
TspDTI ATGAA 2 cut(s) 102, 158
XapI RAATTY 1 cut(s) 76
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.