Rroxscaffold_1G00046540

Cysteine-rich receptor-like protein kinase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
65765515 .. 65776906
11392 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00046540.1

Sequence Viewer

Length: 585 bp
ATGCAACTGTTCCAGGAGGTGAAAAATATCGTGTGCAATGCACTCCAAATAGACAAGGGAAATTGCAGTAATTGCCTTAAGATTTGCATCTCTGTTATTTCACAATGTTGTGGTAGAAAGCAAGGAGCTAGAATTCTTAAACCAAGCTGTAATATAAGGTATGAGGTCAGTCAATTCTATGAGATTACAGCTGATTCGGTAGTAAATGTTTCAGCTCAAGTTACTCCAAAGCAACTCCAACAATTCAAGAAACTCCAGCTCCACTTCCACCTAAGCATGTTATGTAACCACGAGCAGGCTCTTAGTTTCGTGGATTCATTACAATATGATTTTGAAAATATAAGATCTGCTAAGGATGCCTTTTCTGATGAAAATAAGCTTGGCCAAGGTGGATTTGGAGCTGTTTATAAGTTTTTATCTCCTACAGTCGAAACCACCTCCATGGCCATTGTTCCATCTGAGTCGAGATCAGCAATGACCAAGCTCTCAACAACCTCTTCTCTCATCTCCGATGTCCTCATCGTCCTCCTCTGCTCTCTCGTCATCCTTGGCCTTCTCTTCCGCCAAATGAACATCTCCGAGTAG

Protein Analysis

194

Amino Acids

21.57

Weight (kDa)

8.06

Isoelectric Point (pI)

47.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 408
AciI CCGC 1 cut(s) 562
AcoI YGGCCR 2 cut(s) 382, 444
AcsI RAATTY 1 cut(s) 132
AfiI CCNNNNNNNGG 1 cut(s) 295
AflII CTTAAG 1 cut(s) 77
AgsI TTSAA 2 cut(s) 247, 335
AjnI CCWGG 1 cut(s) 12
AjuI GAANNNNNNNTTGG 2 cut(s) 363, 395
AluBI AGCT 8 cut(s) 128, 147, 191, 215, 259, 379, 401, 484
AluI AGCT 8 cut(s) 128, 147, 191, 215, 259, 379, 401, 484
AoxI GGCC 3 cut(s) 382, 444, 550
ApoI RAATTY 1 cut(s) 132
AsuHPI GGTGA 1 cut(s) 31
BalI TGGCCA 2 cut(s) 384, 446
BauI CACGAG 1 cut(s) 290
BccI CCATC 1 cut(s) 463
BciT130I CCWGG 1 cut(s) 14
BfaI CTAG 1 cut(s) 129
BfmI CTRYAG 1 cut(s) 423
BfrI CTTAAG 1 cut(s) 77
BglII AGATCT 1 cut(s) 344
Bme1390I CCNGG 1 cut(s) 14
BmrFI CCNGG 1 cut(s) 14
BmsI GCATC 2 cut(s) 96, 346
BpmI CTGGAG 1 cut(s) 239
Bpu10I CCTNAGC 2 cut(s) 272, 351
BpuEI CTTGAG 1 cut(s) 201
BsaBI GATNNNNATC 1 cut(s) 86
BsaJI CCNNGG 3 cut(s) 385, 441, 547
BsaXI ACNNNNNCTCC 2 cut(s) 243, 273
Bsc4I CCNNNNNNNGG 1 cut(s) 295
Bse3DI GCAATG 2 cut(s) 43, 480
Bse8I GATNNNNATC 1 cut(s) 86
BseBI CCWGG 1 cut(s) 14
BseDI CCNNGG 3 cut(s) 385, 441, 547
BseGI GGATG 2 cut(s) 361, 543
BseJI GATNNNNATC 1 cut(s) 86
BseLI CCNNNNNNNGG 1 cut(s) 295
BseMI GCAATG 2 cut(s) 43, 480
BseMII CTCAG 1 cut(s) 450
BseRI GAGGAG 1 cut(s) 518
BshFI GGCC 3 cut(s) 384, 446, 552
BslI CCNNNNNNNGG 1 cut(s) 295
BsnI GGCC 3 cut(s) 384, 446, 552
Bsp143I GATC 2 cut(s) 344, 467
Bsp19I CCATGG 1 cut(s) 441
BspACI CCGC 1 cut(s) 562
BspANI GGCC 3 cut(s) 384, 446, 552
BspCNI CTCAG 1 cut(s) 451
BspTI CTTAAG 1 cut(s) 77
BsrDI GCAATG 2 cut(s) 43, 480
BssECI CCNNGG 3 cut(s) 385, 441, 547
BssMI GATC 2 cut(s) 344, 467
BssSI CACGAG 1 cut(s) 290
BssT1I CCWWGG 3 cut(s) 385, 441, 547
Bst2BI CACGAG 1 cut(s) 290
Bst2UI CCWGG 1 cut(s) 14
Bst4CI ACNGT 2 cut(s) 9, 427
Bst6I CTCTTC 2 cut(s) 502, 563
BstAFI CTTAAG 1 cut(s) 77
BstAPI GCANNNNNTGC 1 cut(s) 72
BstC8I GCNNGC 1 cut(s) 297
BstDEI CTNAG 4 cut(s) 272, 302, 351, 459
BstDSI CCRYGG 1 cut(s) 441
BstF5I GGATG 2 cut(s) 361, 543
BstKTI GATC 2 cut(s) 347, 470
BstMBI GATC 2 cut(s) 344, 467
BstMWI GCNNNNNNNGC 2 cut(s) 72, 356
BstNI CCWGG 1 cut(s) 14
BstNSI RCATGY 1 cut(s) 280
BstSCI CCNGG 1 cut(s) 12
BstSFI CTRYAG 1 cut(s) 423
BstX2I RGATCY 1 cut(s) 344
BstXI CCANNNNNNTGG 1 cut(s) 442
BstYI RGATCY 1 cut(s) 344
BsuRI GGCC 3 cut(s) 384, 446, 552
BtgI CCRYGG 1 cut(s) 441
BtsCI GGATG 2 cut(s) 361, 543
Cac8I GCNNGC 1 cut(s) 297
CviAII CATG 2 cut(s) 277, 442
DdeI CTNAG 4 cut(s) 272, 302, 351, 459
DpnI GATC 2 cut(s) 346, 469
DpnII GATC 2 cut(s) 344, 467
EaeI YGGCCR 2 cut(s) 382, 444
Eam1104I CTCTTC 2 cut(s) 502, 563
EarI CTCTTC 2 cut(s) 502, 563
EciI GGCGGA 1 cut(s) 551
Eco130I CCWWGG 3 cut(s) 385, 441, 547
EcoRI GAATTC 1 cut(s) 132
EcoRII CCWGG 1 cut(s) 12
EcoT14I CCWWGG 3 cut(s) 385, 441, 547
ErhI CCWWGG 3 cut(s) 385, 441, 547
FaeI CATG 2 cut(s) 280, 445
FaiI YATR 9 cut(s) 155, 162, 180, 278, 283, 327, 341, 408, 443
FalI AAGNNNNNCTT 2 cut(s) 344, 376
FatI CATG 2 cut(s) 276, 441
FokI GGATG 2 cut(s) 368, 530
FspBI CTAG 1 cut(s) 129
GsuI CTGGAG 1 cut(s) 239
HaeIII GGCC 3 cut(s) 384, 446, 552
Hin1II CATG 2 cut(s) 280, 445
HindIII AAGCTT 1 cut(s) 377
HinfI GANTC 3 cut(s) 194, 314, 461
HphI GGTGA 1 cut(s) 31
Hpy188I TCNGA 4 cut(s) 367, 460, 511, 580
Hpy188III TCNNGA 2 cut(s) 247, 465
HpyAV CCTTC 1 cut(s) 563
HpyCH4III ACNGT 2 cut(s) 9, 427
HpyCH4V TGCA 5 cut(s) 4, 36, 41, 66, 87
HpyF10VI GCNNNNNNNGC 2 cut(s) 72, 356
HpyF3I CTNAG 4 cut(s) 272, 302, 351, 459
Hsp92II CATG 2 cut(s) 280, 445
Kzo9I GATC 2 cut(s) 344, 467
LmnI GCTCC 3 cut(s) 125, 264, 398
LpnPI CCDG 3 cut(s) 26, 269, 281
LweI GCATC 2 cut(s) 96, 346
MaeI CTAG 1 cut(s) 129
MaeIII GTNAC 2 cut(s) 220, 284
MalI GATC 2 cut(s) 346, 469
MboI GATC 2 cut(s) 344, 467
MboII GAAGA 2 cut(s) 489, 550
MflI RGATCY 1 cut(s) 344
MlsI TGGCCA 2 cut(s) 384, 446
MluCI AATT 5 cut(s) 61, 70, 132, 173, 242
MluNI TGGCCA 2 cut(s) 384, 446
MlyI GAGTC 1 cut(s) 470
MmeI TCCRAC 1 cut(s) 262
MnlI CCTC 7 cut(s) 10, 157, 448, 505, 527, 536, 539
Mox20I TGGCCA 2 cut(s) 384, 446
MscI TGGCCA 2 cut(s) 384, 446
MseI TTAA 2 cut(s) 78, 138
MslI CAYNNNNRTG 1 cut(s) 440
Msp20I TGGCCA 2 cut(s) 384, 446
MspA1I CMGCKG 1 cut(s) 191
MspCI CTTAAG 1 cut(s) 77
MspR9I CCNGG 1 cut(s) 14
MvaI CCWGG 1 cut(s) 14
MwoI GCNNNNNNNGC 2 cut(s) 72, 356
NcoI CCATGG 1 cut(s) 441
NdeII GATC 2 cut(s) 344, 467
NlaIII CATG 2 cut(s) 280, 445
NspI RCATGY 1 cut(s) 280
PfeI GAWTC 2 cut(s) 194, 314
PfoI TCCNGGA 1 cut(s) 12
PleI GAGTC 1 cut(s) 469
PpsI GAGTC 1 cut(s) 469
PsiI TTATAA 1 cut(s) 408
Psp6I CCWGG 1 cut(s) 12
PspGI CCWGG 1 cut(s) 12
PsuI RGATCY 1 cut(s) 344
PvuII CAGCTG 1 cut(s) 191
RseI CAYNNNNRTG 1 cut(s) 440
SaqAI TTAA 2 cut(s) 78, 138
Sau3AI GATC 2 cut(s) 344, 467
SchI GAGTC 1 cut(s) 470
ScrFI CCNGG 1 cut(s) 14
SfaNI GCATC 2 cut(s) 96, 346
SfcI CTRYAG 1 cut(s) 423
SmiMI CAYNNNNRTG 1 cut(s) 440
SmlI CTYRAG 2 cut(s) 77, 216
SmoI CTYRAG 2 cut(s) 77, 216
Sse9I AATT 5 cut(s) 61, 70, 132, 173, 242
SsiI CCGC 1 cut(s) 562
SspMI CTAG 1 cut(s) 129
StyD4I CCNGG 1 cut(s) 12
StyI CCWWGG 3 cut(s) 385, 441, 547
TaaI ACNGT 2 cut(s) 9, 427
TaqI TCGA 2 cut(s) 429, 464
TasI AATT 5 cut(s) 61, 70, 132, 173, 242
TfiI GAWTC 2 cut(s) 194, 314
Tru1I TTAA 2 cut(s) 78, 138
Tru9I TTAA 2 cut(s) 78, 138
TspDTI ATGAA 3 cut(s) 306, 384, 584
Vha464I CTTAAG 1 cut(s) 77
XapI RAATTY 1 cut(s) 132
XceI RCATGY 1 cut(s) 280
XcmI CCANNNNNNNNNTGG 1 cut(s) 392
XspI CTAG 1 cut(s) 129
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.