Rroxscaffold_2G00099460

Protein of unknown function (DUF1639)

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
21158798 .. 21159572
775 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00099460.1

Sequence Viewer

Length: 300 bp
ATGGCTGGATCTAAATCCTATGGAGTGGTATTCTGTTTCAGGTTTGTAATCCTAGAAGTTGACTTGGCAAATTCATTTAGCATTTATGTTATCTATGGGAATATTCAGAACCTGGGCCTTATTCGTCTTCTTGATTACATTGTTAATGACATTCCAAAACATGCCCAAAAAGTCTTGTTTCCCGGTATATGGTTGAATGAGGTCTTAGTTGATTCATACAAGGTTCCTGAATTCCCTGAAAATGTCAAGGTATTTTTGCTTTCTTCTGAGTTCTCTCTAAAAGTTTCATGCTTTCATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

99

Amino Acids

11.31

Weight (kDa)

6.04

Isoelectric Point (pI)

25.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 16
AcsI RAATTY 2 cut(s) 70, 230
AfiI CCNNNNNNNGG 1 cut(s) 189
AgsI TTSAA 1 cut(s) 196
AjnI CCWGG 1 cut(s) 111
AlwI GGATC 1 cut(s) 16
AlwNI CAGNNNCTG 1 cut(s) 112
AoxI GGCC 1 cut(s) 115
ApoI RAATTY 2 cut(s) 70, 230
AspS9I GGNCC 1 cut(s) 115
AsuC2I CCSGG 1 cut(s) 183
BbsI GAAGAC 1 cut(s) 119
BciT130I CCWGG 1 cut(s) 113
BcnI CCSGG 1 cut(s) 183
BfaI CTAG 1 cut(s) 53
Bme1390I CCNGG 2 cut(s) 113, 183
BmgT120I GGNCC 1 cut(s) 115
BmiI GGNNCC 1 cut(s) 225
BmrFI CCNGG 2 cut(s) 113, 183
BpiI GAAGAC 1 cut(s) 119
BpuMI CCSGG 1 cut(s) 183
BsaBI GATNNNNATC 1 cut(s) 13
BsaJI CCNNGG 1 cut(s) 112
Bsc4I CCNNNNNNNGG 1 cut(s) 189
Bse8I GATNNNNATC 1 cut(s) 13
BseBI CCWGG 1 cut(s) 113
BseDI CCNNGG 1 cut(s) 112
BseJI GATNNNNATC 1 cut(s) 13
BseLI CCNNNNNNNGG 1 cut(s) 189
BseMII CTCAG 1 cut(s) 258
BshFI GGCC 1 cut(s) 117
BsiSI CCGG 1 cut(s) 183
BslI CCNNNNNNNGG 1 cut(s) 189
BsnI GGCC 1 cut(s) 117
Bsp143I GATC 1 cut(s) 8
BspANI GGCC 1 cut(s) 117
BspCNI CTCAG 1 cut(s) 259
BspLI GGNNCC 1 cut(s) 225
BspPI GGATC 1 cut(s) 16
BssECI CCNNGG 1 cut(s) 112
BssMI GATC 1 cut(s) 8
Bst2UI CCWGG 1 cut(s) 113
BstDEI CTNAG 2 cut(s) 205, 267
BstKTI GATC 1 cut(s) 11
BstMBI GATC 1 cut(s) 8
BstNI CCWGG 1 cut(s) 113
BstNSI RCATGY 1 cut(s) 164
BstSCI CCNGG 2 cut(s) 111, 181
BstV2I GAAGAC 1 cut(s) 119
BstX2I RGATCY 1 cut(s) 8
BstYI RGATCY 1 cut(s) 8
BsuRI GGCC 1 cut(s) 117
CaiI CAGNNNCTG 1 cut(s) 112
Cfr13I GGNCC 1 cut(s) 115
CviAII CATG 2 cut(s) 161, 288
CviJI RGCY 2 cut(s) 5, 117
CviKI_1 RGCY 2 cut(s) 5, 117
DdeI CTNAG 2 cut(s) 205, 267
DpnI GATC 1 cut(s) 10
DpnII GATC 1 cut(s) 8
EcoRI GAATTC 1 cut(s) 230
EcoRII CCWGG 1 cut(s) 111
FaeI CATG 2 cut(s) 164, 291
FaiI YATR 8 cut(s) 21, 87, 96, 162, 188, 190, 217, 289
FatI CATG 2 cut(s) 160, 287
FspBI CTAG 1 cut(s) 53
HaeIII GGCC 1 cut(s) 117
HapII CCGG 1 cut(s) 183
Hin1II CATG 2 cut(s) 164, 291
HincII GTYRAC 1 cut(s) 61
HindII GTYRAC 1 cut(s) 61
HinfI GANTC 1 cut(s) 212
HpaII CCGG 1 cut(s) 183
Hpy166II GTNNAC 1 cut(s) 61
Hpy188I TCNGA 2 cut(s) 108, 268
Hpy188III TCNNGA 2 cut(s) 131, 227
Hpy8I GTNNAC 1 cut(s) 61
HpyF3I CTNAG 2 cut(s) 205, 267
Hsp92II CATG 2 cut(s) 164, 291
Kzo9I GATC 1 cut(s) 8
LpnPI CCDG 6 cut(s) 25, 98, 125, 196, 240, 249
MaeI CTAG 1 cut(s) 53
MalI GATC 1 cut(s) 10
MboI GATC 1 cut(s) 8
MboII GAAGA 2 cut(s) 119, 255
MflI RGATCY 1 cut(s) 8
MluCI AATT 2 cut(s) 70, 230
MnlI CCTC 1 cut(s) 193
MseI TTAA 1 cut(s) 144
MspI CCGG 1 cut(s) 183
MspR9I CCNGG 2 cut(s) 113, 183
MvaI CCWGG 1 cut(s) 113
NciI CCSGG 1 cut(s) 183
NdeII GATC 1 cut(s) 8
NlaIII CATG 2 cut(s) 164, 291
NlaIV GGNNCC 1 cut(s) 225
NspI RCATGY 1 cut(s) 164
PfeI GAWTC 1 cut(s) 212
Psp6I CCWGG 1 cut(s) 111
PspGI CCWGG 1 cut(s) 111
PspN4I GGNNCC 1 cut(s) 225
PspPI GGNCC 1 cut(s) 115
PstNI CAGNNNCTG 1 cut(s) 112
PsuI RGATCY 1 cut(s) 8
SaqAI TTAA 1 cut(s) 144
Sau3AI GATC 1 cut(s) 8
Sau96I GGNCC 1 cut(s) 115
ScrFI CCNGG 2 cut(s) 113, 183
SetI ASST 5 cut(s) 44, 114, 204, 225, 252
Sse9I AATT 2 cut(s) 70, 230
SspI AATATT 1 cut(s) 103
SspMI CTAG 1 cut(s) 53
StyD4I CCNGG 2 cut(s) 111, 181
TasI AATT 2 cut(s) 70, 230
TfiI GAWTC 1 cut(s) 212
Tru1I TTAA 1 cut(s) 144
Tru9I TTAA 1 cut(s) 144
TspDTI ATGAA 4 cut(s) 63, 204, 276, 284
XapI RAATTY 2 cut(s) 70, 230
XceI RCATGY 1 cut(s) 164
XspI CTAG 1 cut(s) 53
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.