Rh6AG043500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Forward (+)
6384847 .. 6388376
3530 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG043500.1

Sequence Viewer

Length: 276 bp
ATGGGTGAAGAGGTTGGGAGTATCAATGTGCTTACAAGTTATCTGAGGTTTGTAATCCTAGAAGTTGACTTGGCAAATTCATTTAGCATTTATGTTATCTCTGGGAATAATCAGAACCAGGGCCTCATTCGTCTTCTTGATTTCATTGTTAATGACATTTCAAAACATGCCCAAAAAGCGTTGTTTCCCGGTATATGGTTGATGGAGGTCTCAGTTGATTCGTACTTCCTGAATTCCCTGAAAATGTCAAGATGGAATACCAGCTACCTCAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

91

Amino Acids

10.36

Weight (kDa)

5.08

Isoelectric Point (pI)

29.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 76, 232
AfaI GTAC 1 cut(s) 224
AfiI CCNNNNNNNGG 1 cut(s) 195
AgsI TTSAA 1 cut(s) 162
AjnI CCWGG 1 cut(s) 117
AluBI AGCT 1 cut(s) 264
AluI AGCT 1 cut(s) 264
Alw26I GTCTC 1 cut(s) 214
AoxI GGCC 1 cut(s) 121
ApoI RAATTY 2 cut(s) 76, 232
AspS9I GGNCC 1 cut(s) 121
AsuC2I CCSGG 1 cut(s) 189
AsuHPI GGTGA 1 cut(s) 17
BbsI GAAGAC 1 cut(s) 125
BccI CCATC 2 cut(s) 196, 246
BciT130I CCWGG 1 cut(s) 119
BcnI CCSGG 1 cut(s) 189
BcoDI GTCTC 1 cut(s) 214
BfaI CTAG 1 cut(s) 59
Bme1390I CCNGG 2 cut(s) 119, 189
BmgT120I GGNCC 1 cut(s) 121
BmrFI CCNGG 2 cut(s) 119, 189
BpiI GAAGAC 1 cut(s) 125
BpuMI CCSGG 1 cut(s) 189
BsaI GGTCTC 1 cut(s) 214
BsaJI CCNNGG 1 cut(s) 118
Bsc4I CCNNNNNNNGG 1 cut(s) 195
BseBI CCWGG 1 cut(s) 119
BseDI CCNNGG 1 cut(s) 118
BseLI CCNNNNNNNGG 1 cut(s) 195
BseMII CTCAG 2 cut(s) 35, 225
BshFI GGCC 1 cut(s) 123
BsiSI CCGG 1 cut(s) 189
BslI CCNNNNNNNGG 1 cut(s) 195
BsmAI GTCTC 1 cut(s) 214
BsnI GGCC 1 cut(s) 123
Bso31I GGTCTC 1 cut(s) 214
BspANI GGCC 1 cut(s) 123
BspCNI CTCAG 2 cut(s) 36, 224
BspTNI GGTCTC 1 cut(s) 214
BssECI CCNNGG 1 cut(s) 118
Bst2UI CCWGG 1 cut(s) 119
Bst6I CTCTTC 1 cut(s) 3
BstDEI CTNAG 2 cut(s) 44, 211
BstMAI GTCTC 1 cut(s) 214
BstMWI GCNNNNNNNGC 1 cut(s) 176
BstNI CCWGG 1 cut(s) 119
BstNSI RCATGY 1 cut(s) 170
BstSCI CCNGG 2 cut(s) 117, 187
BstV2I GAAGAC 1 cut(s) 125
BsuRI GGCC 1 cut(s) 123
Cfr13I GGNCC 1 cut(s) 121
Csp6I GTAC 1 cut(s) 223
CviAII CATG 1 cut(s) 167
CviJI RGCY 2 cut(s) 123, 264
CviKI_1 RGCY 2 cut(s) 123, 264
CviQI GTAC 1 cut(s) 223
DdeI CTNAG 2 cut(s) 44, 211
Eam1104I CTCTTC 1 cut(s) 3
EarI CTCTTC 1 cut(s) 3
Eco31I GGTCTC 1 cut(s) 214
EcoO109I RGGNCCY 1 cut(s) 121
EcoRI GAATTC 1 cut(s) 232
EcoRII CCWGG 1 cut(s) 117
FaeI CATG 1 cut(s) 170
FaiI YATR 4 cut(s) 93, 168, 194, 196
FatI CATG 1 cut(s) 166
FspBI CTAG 1 cut(s) 59
HaeIII GGCC 1 cut(s) 123
HapII CCGG 1 cut(s) 189
Hin1II CATG 1 cut(s) 170
HincII GTYRAC 1 cut(s) 67
HindII GTYRAC 1 cut(s) 67
HinfI GANTC 1 cut(s) 218
HpaII CCGG 1 cut(s) 189
HphI GGTGA 1 cut(s) 17
Hpy166II GTNNAC 1 cut(s) 67
Hpy188I TCNGA 2 cut(s) 45, 114
Hpy188III TCNNGA 3 cut(s) 137, 229, 249
Hpy8I GTNNAC 1 cut(s) 67
HpyF10VI GCNNNNNNNGC 1 cut(s) 176
HpyF3I CTNAG 2 cut(s) 44, 211
Hsp92II CATG 1 cut(s) 170
LpnPI CCDG 6 cut(s) 87, 104, 131, 202, 242, 251
MaeI CTAG 1 cut(s) 59
MboII GAAGA 2 cut(s) 20, 125
MluCI AATT 2 cut(s) 76, 232
MnlI CCTC 4 cut(s) 4, 39, 134, 199
MseI TTAA 1 cut(s) 150
MspI CCGG 1 cut(s) 189
MspR9I CCNGG 2 cut(s) 119, 189
MvaI CCWGG 1 cut(s) 119
MwoI GCNNNNNNNGC 1 cut(s) 176
NciI CCSGG 1 cut(s) 189
NlaIII CATG 1 cut(s) 170
NspI RCATGY 1 cut(s) 170
PfeI GAWTC 1 cut(s) 218
Psp6I CCWGG 1 cut(s) 117
PspGI CCWGG 1 cut(s) 117
PspPI GGNCC 1 cut(s) 121
RsaI GTAC 1 cut(s) 224
RsaNI GTAC 1 cut(s) 223
SaqAI TTAA 1 cut(s) 150
Sau96I GGNCC 1 cut(s) 121
ScrFI CCNGG 2 cut(s) 119, 189
SetI ASST 5 cut(s) 15, 50, 210, 266, 270
Sse9I AATT 2 cut(s) 76, 232
SspMI CTAG 1 cut(s) 59
StyD4I CCNGG 2 cut(s) 117, 187
TasI AATT 2 cut(s) 76, 232
TfiI GAWTC 1 cut(s) 218
Tru1I TTAA 1 cut(s) 150
Tru9I TTAA 1 cut(s) 150
TspDTI ATGAA 2 cut(s) 69, 133
XapI RAATTY 2 cut(s) 76, 232
XceI RCATGY 1 cut(s) 170
XspI CTAG 1 cut(s) 59
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.