Rh2AG427100

membrane protein At1g06890-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Reverse (-)
63473000 .. 63478564
5565 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG427100.1

Sequence Viewer

Length: 363 bp
ATGGGTGAAGAGGTTGGGAGTATCAATGTGCTTACAAGCTACAAACTTGACAAGCTGGCCTTTTTAGTCACATTTTGTTCCCTTCATGTGGCTTTGAGGATGAGATTCTTTGAACAAAAACCTCTGGATCAAAAGATTGTTATGAGCTGTGGCATTATGAATGGGATCTCCATAGGACTTTTAGACCTGAGCCTGGGGTTTAATTCTATTGACTTTTATCAGGTGGTGCTTTTCTGTTTCATGTCCATTCCAAAGGTAATTTTGGGGTGCTGGTTTCATTGTTTGGCTCGGCCAGCGACTTTAGCCAATATACCGAAGGGTATTTATTACGAAGTTTTGTCTAGCGATTCTCATCCTTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

120

Amino Acids

13.41

Weight (kDa)

6.8

Isoelectric Point (pI)

33.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 135, 173
AcoI YGGCCR 1 cut(s) 290
AfiI CCNNNNNNNGG 2 cut(s) 88, 193
AgsI TTSAA 1 cut(s) 113
AjnI CCWGG 1 cut(s) 192
AluBI AGCT 3 cut(s) 39, 55, 147
AluI AGCT 3 cut(s) 39, 55, 147
AlwI GGATC 2 cut(s) 135, 173
AoxI GGCC 2 cut(s) 57, 290
AsuHPI GGTGA 1 cut(s) 17
BciT130I CCWGG 1 cut(s) 194
BfaI CTAG 1 cut(s) 342
Bme1390I CCNGG 1 cut(s) 194
BmrFI CCNGG 1 cut(s) 194
Bpu10I CCTNAGC 1 cut(s) 188
BsaBI GATNNNNATC 1 cut(s) 351
BsaJI CCNNGG 1 cut(s) 193
Bsc4I CCNNNNNNNGG 2 cut(s) 88, 193
Bse8I GATNNNNATC 1 cut(s) 351
BseBI CCWGG 1 cut(s) 194
BseDI CCNNGG 1 cut(s) 193
BseGI GGATG 2 cut(s) 105, 352
BseJI GATNNNNATC 1 cut(s) 351
BseLI CCNNNNNNNGG 2 cut(s) 88, 193
BseMII CTCAG 1 cut(s) 179
BshFI GGCC 2 cut(s) 59, 292
BslI CCNNNNNNNGG 2 cut(s) 88, 193
BsnI GGCC 2 cut(s) 59, 292
Bsp143I GATC 2 cut(s) 127, 165
BspANI GGCC 2 cut(s) 59, 292
BspCNI CTCAG 1 cut(s) 180
BspPI GGATC 2 cut(s) 135, 173
BssECI CCNNGG 1 cut(s) 193
BssMI GATC 2 cut(s) 127, 165
Bst2UI CCWGG 1 cut(s) 194
Bst6I CTCTTC 1 cut(s) 3
BstC8I GCNNGC 2 cut(s) 57, 294
BstDEI CTNAG 1 cut(s) 188
BstF5I GGATG 2 cut(s) 105, 352
BstKTI GATC 2 cut(s) 130, 168
BstMBI GATC 2 cut(s) 127, 165
BstMWI GCNNNNNNNGC 2 cut(s) 293, 302
BstNI CCWGG 1 cut(s) 194
BstSCI CCNGG 1 cut(s) 192
BstX2I RGATCY 1 cut(s) 165
BstYI RGATCY 1 cut(s) 165
BsuRI GGCC 2 cut(s) 59, 292
BtsCI GGATG 2 cut(s) 105, 352
Cac8I GCNNGC 2 cut(s) 57, 294
CviAII CATG 2 cut(s) 86, 241
CviJI RGCY 9 cut(s) 39, 55, 59, 92, 147, 192, 287, 292, 305
CviKI_1 RGCY 9 cut(s) 39, 55, 59, 92, 147, 192, 287, 292, 305
DdeI CTNAG 1 cut(s) 188
DpnI GATC 2 cut(s) 129, 167
DpnII GATC 2 cut(s) 127, 165
EaeI YGGCCR 1 cut(s) 290
Eam1104I CTCTTC 1 cut(s) 3
EarI CTCTTC 1 cut(s) 3
EcoRII CCWGG 1 cut(s) 192
FaeI CATG 2 cut(s) 89, 244
FaiI YATR 6 cut(s) 87, 143, 158, 173, 242, 311
FalI AAGNNNNNCTT 2 cut(s) 44, 76
FatI CATG 2 cut(s) 85, 240
FokI GGATG 2 cut(s) 112, 339
FspBI CTAG 1 cut(s) 342
HaeIII GGCC 2 cut(s) 59, 292
Hin1II CATG 2 cut(s) 89, 244
HinfI GANTC 2 cut(s) 105, 347
HphI GGTGA 1 cut(s) 17
Hpy188III TCNNGA 2 cut(s) 125, 360
HpyAV CCTTC 2 cut(s) 92, 310
HpyF10VI GCNNNNNNNGC 2 cut(s) 293, 302
HpyF3I CTNAG 1 cut(s) 188
Hsp92II CATG 2 cut(s) 89, 244
Kzo9I GATC 2 cut(s) 127, 165
LpnPI CCDG 8 cut(s) 41, 110, 179, 200, 206, 206, 256, 306
MaeI CTAG 1 cut(s) 342
MaeIII GTNAC 1 cut(s) 67
MalI GATC 2 cut(s) 129, 167
MboI GATC 2 cut(s) 127, 165
MboII GAAGA 1 cut(s) 20
MflI RGATCY 1 cut(s) 165
MluCI AATT 2 cut(s) 202, 258
MnlI CCTC 3 cut(s) 4, 90, 132
MseI TTAA 1 cut(s) 201
MspR9I CCNGG 1 cut(s) 194
MvaI CCWGG 1 cut(s) 194
MwoI GCNNNNNNNGC 2 cut(s) 293, 302
NdeII GATC 2 cut(s) 127, 165
NlaIII CATG 2 cut(s) 89, 244
NmeAIII GCCGAG 1 cut(s) 268
NmuCI GTSAC 1 cut(s) 67
PfeI GAWTC 2 cut(s) 105, 347
Psp6I CCWGG 1 cut(s) 192
PspGI CCWGG 1 cut(s) 192
PsuI RGATCY 1 cut(s) 165
SaqAI TTAA 1 cut(s) 201
Sau3AI GATC 2 cut(s) 127, 165
ScrFI CCNGG 1 cut(s) 194
SetI ASST 8 cut(s) 15, 41, 57, 124, 149, 189, 225, 258
Sse9I AATT 2 cut(s) 202, 258
SspMI CTAG 1 cut(s) 342
StyD4I CCNGG 1 cut(s) 192
TasI AATT 2 cut(s) 202, 258
TfiI GAWTC 2 cut(s) 105, 347
Tru1I TTAA 1 cut(s) 201
Tru9I TTAA 1 cut(s) 201
TseFI GTSAC 1 cut(s) 67
Tsp45I GTSAC 1 cut(s) 67
TspDTI ATGAA 4 cut(s) 74, 173, 229, 266
XspI CTAG 1 cut(s) 342
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.