RchiOBHm_Chr7g0234091

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
58682542 .. 58683176
635 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ20978

Sequence Viewer

Length: 192 bp
ATGGCTCGCACACCGATCAGATCTCTCGCACACCGATCAACATCTCATTCTTGTCGTTCTCTCTTCCATCGTTCTCTTTACCGTTCTAAGCAGCCATGGCGACCGCTGCGTTGCTCCGATCTCTACGACGTCATGACCTCGCTTCAGCCCCTCTGTTCCTACTGCTTGCCGAAGTACCGATCTAGGAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

7.53

Weight (kDa)

10.63

Isoelectric Point (pI)

85.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 132
AciI CCGC 1 cut(s) 104
AcuI CTGAAG 1 cut(s) 128
AcyI GRCGYC 1 cut(s) 129
AfaI GTAC 1 cut(s) 176
ApeKI GCWGC 2 cut(s) 91, 106
BbvI GCAGC 2 cut(s) 93, 103
BccI CCATC 1 cut(s) 75
BfaI CTAG 1 cut(s) 183
BglII AGATCT 1 cut(s) 20
BisI GCNGC 2 cut(s) 92, 107
BlsI GCNGC 2 cut(s) 93, 108
BsaBI GATNNNNATC 1 cut(s) 40
BsaHI GRCGYC 1 cut(s) 129
BsaJI CCNNGG 1 cut(s) 95
Bse8I GATNNNNATC 1 cut(s) 40
BseDI CCNNGG 1 cut(s) 95
BseJI GATNNNNATC 1 cut(s) 40
BseXI GCAGC 2 cut(s) 93, 103
Bsh1285I CGRYCG 1 cut(s) 104
BsiEI CGRYCG 1 cut(s) 104
Bsp143I GATC 5 cut(s) 15, 20, 35, 118, 179
Bsp19I CCATGG 1 cut(s) 95
BspACI CCGC 1 cut(s) 104
BspHI TCATGA 1 cut(s) 132
BssECI CCNNGG 1 cut(s) 95
BssMI GATC 5 cut(s) 15, 20, 35, 118, 179
BssNI GRCGYC 1 cut(s) 129
BssT1I CCWWGG 1 cut(s) 95
Bst4CI ACNGT 1 cut(s) 83
Bst6I CTCTTC 1 cut(s) 68
BstACI GRCGYC 1 cut(s) 129
BstC8I GCNNGC 2 cut(s) 7, 167
BstDEI CTNAG 1 cut(s) 87
BstDSI CCRYGG 1 cut(s) 95
BstKTI GATC 5 cut(s) 18, 23, 38, 121, 182
BstMBI GATC 5 cut(s) 15, 20, 35, 118, 179
BstMCI CGRYCG 1 cut(s) 104
BstMWI GCNNNNNNNGC 2 cut(s) 97, 106
BstV1I GCAGC 2 cut(s) 93, 103
BstX2I RGATCY 1 cut(s) 20
BstYI RGATCY 1 cut(s) 20
BtgI CCRYGG 1 cut(s) 95
Cac8I GCNNGC 2 cut(s) 7, 167
CciI TCATGA 1 cut(s) 132
Csp6I GTAC 1 cut(s) 175
CviAII CATG 2 cut(s) 96, 133
CviJI RGCY 3 cut(s) 5, 94, 148
CviKI_1 RGCY 3 cut(s) 5, 94, 148
CviQI GTAC 1 cut(s) 175
DdeI CTNAG 1 cut(s) 87
DpnI GATC 5 cut(s) 17, 22, 37, 120, 181
DpnII GATC 5 cut(s) 15, 20, 35, 118, 179
Eam1104I CTCTTC 1 cut(s) 68
EarI CTCTTC 1 cut(s) 68
Eco130I CCWWGG 1 cut(s) 95
Eco57I CTGAAG 1 cut(s) 128
EcoT14I CCWWGG 1 cut(s) 95
ErhI CCWWGG 1 cut(s) 95
FaeI CATG 2 cut(s) 99, 136
FaiI YATR 2 cut(s) 97, 134
FatI CATG 2 cut(s) 95, 132
Fnu4HI GCNGC 2 cut(s) 92, 107
Fsp4HI GCNGC 2 cut(s) 92, 107
FspBI CTAG 1 cut(s) 183
GluI GCNGC 2 cut(s) 92, 107
Hin1I GRCGYC 1 cut(s) 129
Hin1II CATG 2 cut(s) 99, 136
Hpy188I TCNGA 2 cut(s) 20, 118
Hpy188III TCNNGA 1 cut(s) 133
Hpy99I CGWCG 1 cut(s) 131
HpyCH4III ACNGT 1 cut(s) 83
HpyCH4IV ACGT 1 cut(s) 129
HpyF10VI GCNNNNNNNGC 2 cut(s) 97, 106
HpyF3I CTNAG 1 cut(s) 87
HpySE526I ACGT 1 cut(s) 129
Hsp92I GRCGYC 1 cut(s) 129
Hsp92II CATG 2 cut(s) 99, 136
Kzo9I GATC 5 cut(s) 15, 20, 35, 118, 179
LmnI GCTCC 1 cut(s) 119
Lsp1109I GCAGC 2 cut(s) 93, 103
MaeI CTAG 1 cut(s) 183
MaeII ACGT 1 cut(s) 129
MalI GATC 5 cut(s) 17, 22, 37, 120, 181
MboI GATC 5 cut(s) 15, 20, 35, 118, 179
MboII GAAGA 1 cut(s) 55
MflI RGATCY 1 cut(s) 20
MnlI CCTC 2 cut(s) 148, 161
MspA1I CMGCKG 1 cut(s) 106
MwoI GCNNNNNNNGC 2 cut(s) 97, 106
NcoI CCATGG 1 cut(s) 95
NdeII GATC 5 cut(s) 15, 20, 35, 118, 179
NlaIII CATG 2 cut(s) 99, 136
PagI TCATGA 1 cut(s) 132
PkrI GCNGC 2 cut(s) 93, 108
PsuI RGATCY 1 cut(s) 20
RsaI GTAC 1 cut(s) 176
RsaNI GTAC 1 cut(s) 175
SatI GCNGC 2 cut(s) 92, 107
Sau3AI GATC 5 cut(s) 15, 20, 35, 118, 179
SetI ASST 2 cut(s) 132, 140
SgeI CNNG 7 cut(s) 18, 38, 63, 108, 145, 151, 178
SsiI CCGC 1 cut(s) 104
SspMI CTAG 1 cut(s) 183
StyI CCWWGG 1 cut(s) 95
TaaI ACNGT 1 cut(s) 83
TaiI ACGT 1 cut(s) 132
TseI GCWGC 2 cut(s) 91, 106
XspI CTAG 1 cut(s) 183
ZraI GACGTC 1 cut(s) 130
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.